Description :
From Genome Similarity Track
Location :
Scaffold_242:15756- 23439
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_242-fgenesh-gene-0.6Alcohol dehydrogenase
Pytiw_DAOMBR242034maker-piw_contig_242-fgenesh-gene-0.7Alcohol dehydrogenase
Pytiw_DAOMBR242034maker-piw_contig_242-fgenesh-gene-0.2F-box protein

Sequence
7683 bases(100 bases per row)
CAGGGTCGTTGGGGGAGACTTCGTCCGGGCGGTCCAAGATCGTAGGGTCCAACTCTTCAGCAGCCATCTTCATCTTCGCTTGTTCGATTGGCATCCCCAT
TTGGAGCAGCTTGAAGTATTTTTTGAAAGCTGGATCATCCTTAACCAGCAGAGGAACGTAGGGTGGCGCTGGAACAGAGGATATCTGCGGAAGAAGACCA
GCTGGAAAGACTGGCATGTTCATTCTCATCGCACTGTGATCGACCGGTTCTGGAGGCTAGAGTTGTTCAAGCAAGCACGTCAGAGCTTGGCACACCAAAA
CATAAATAGTGTAAATAAGTGACGAGTATCGCTTACACCAGGGTCGTTAGGAGACACTTGGGTTGGTTGGTCCAGCAGGTCGGCGTCCACGCCATCCGCT
TCCATCTTGAGTTTGATTTGGTCGATGGGCATGTTCATGTTTTTCAGCTTGAAGTACTTCTTGAAAACAGGATCATTCCCAACAGTAAGAGGAATGTAAG
CACCTGGCGCTGGCTGAACTTACATAAACACCAGCACAGATCCAAAATCATGTCAGTGGCAAACTTTCAACAACAACAAGAGGAATCACTGGCAACAAAC
AACGTACCCCAGGGTCGTTTGGTGAGACCTCGTCCGGAGTGTCCAAGAGCGCCGGGTTCACTCCATCACCTTCCATTTTCGCCTTGATCTGCTCTGCTGG
CATCGCCATCTCCTTCAACTTGAAGTACTTGCGGAATTCTGGATCGTCTTTCACCAAAAGCGGTCTGTAGATTCGCTGCACGCCGCCCATGTGACTGCCT
CCAGGGGACATATTCTGTGTCTTCTTCTCCAGTTCAAGCAGCTTCTTCTGCAGATCTTTGATATCCTTGAGCTTCACAGGCGCAGAGCTGGAAGTTGTGC
GATCGCGGATCGATGGCTCTGCCGACACTTTCGACTGCGCCTCGATGAGTTTTTCAATCTGCGACTGCAGCTGCCCAATCACTTTCGTGTCTGCCATGTT
ATCCGACTTGGACGACAGCTCCAGAAGTTTCTTGATCTGCGACTCGGTGAGTCCCGGGATCTGGAAGCCACTCATGCTCGCGCTCGGTCCACTGGAGCGT
CGCGAGCTCTGCGACGATGAGCGCGTGACGGCCGCGTGGGCCACGTTCTCGCTCTCCTCCTCGCTCTCTTCCTCCTCCGACGAGTCCTCTTCCTCCTCGC
TCTCCTCTTTCTGCATTCGTGCTGCACAATCGCACCCACATAACAGCGCACATTAGCTCCTGCCGCCACGTTGGCAACCGAATAAAAAGTGCCAGTCGTC
ACGTACCAGTGATGCAGAATGCGCGATGCGATTTCGCATTACGACGCAGACACGTCTACAGAAGAGAGCACACACAAATCCACATACCGTCAGCCCATAC
CCACCACAGAGCGAGCATACACATAGTGATAAAAACACAAGGACTGTCGCACCTCGTTGCAGTAGTGTGCTGAGTGGCAGATCGTGCAGACCGTCGTGGC
GTGCGGCTGGCCGCAGTGCACGCAGTCCTCGCCGCGCGCGCGCATGTTGGAGGCCATGACGGCACTCGTGAGGCGGCTCATGAGCTCATCGTCGCTGTCG
CTGTCCGCCATCGCTCGTGAGGCTTCGTCTCCTGCGGCTCTTCTCTGCGAATGGCACTTTCTTCTGCTTCGCTTCACTTCGCTTCACACCCAAGATAGAA
AAGGAGCTGGGTGACAAAATAGGCTGAACGCGGTTTCGTCTCATCTGGAGTGTGGAAGGCGCATAAACATTTTTGACATTTTTCGAACGAAGCGATTGTG
GACATAACTCATAACCACTTTGAATTGGATTGCTGTAGCAAAGTTGTATGAACATTCTGTCACGTTTGCTGAACAAAATAGGTTGAGTACATTTCGCATA
GAATTGAAGGTTTTGGTCGTTTGGTTTTTATGACATGTTGAAGATGATGCATTCACTCCTGGAATTTTGATGAAGAATGCGGAATTGCTCCAAGATGAGC
GCGGTACGCATCTGTCCAACGCCGAGGCGCCTGCATGCGCTCCCAGTACGTGCGTATAGTAGTGTATGATGCGCTTAGGCGAGCTTCACGATGAGCTTGC
CGATGTTCTGCTTGGCGAAGAGCCGGTCGATCGCGTCGGCGATGCCCTCGAGCCCGTGGAACTCGGTCGGGTCGACGCCCGTCTTGAGCTTACCTTCATG
GATGAGCGCGAGCAGCTTGGCGATGTACTCGGGAATAAATGGAGCGAAGTTGAGCAGGAAGAAGCCGCGCAGCGACACGGACTTGCGCTGGATCGTGTGG
TTCACGTCCGGCGACAGCAGCGGGTTTTCCACCTGCGCGCCCAGGTAGCCCGAAACCGCGCCGAAGAGGATGATGCGGCCGTGCACCGCGATGTTGGCGA
GTACCGTCTTAAAGACGTCGCCGCCGACGCTCTCGAACACGAGATCGAGACCCTTTGGGTACTCGTTCTTGAGCACTGTGTCGATGTCCTCCTTGGCGTA
ATTGATCACGCGGTCACAACCGAGCGCCTTGAGGTGTTCAACCTTTTCGTCTGACGAGCACGTACCGATGACGTGGTTGCCCGCAAGCTTGGCGAGCTGC
ACGACGAACTGGCCAGTCGCACCAGCCGCCGCAGTGACGAAGACGGTCTCGTTCGTGCCCATCTGACCGACCTTCTCGAGCGCGAGGATCGCAGATACGC
CGCACACGGTGAGAGGCACCATGAGCGGCGACACCTCGGGTGTCTTGAGCAGCGTCGCAGCGCCCACCTCGGCGTACTCGGCGAACGCACCAAACTCTGA
TTGCGAACAGGTAACAGAGAGCGTCGTCAGATACAGAGGCAGCTCATAAGCGTGCATCATGAGAGCACGCAAGGTACGCACTCTGGTAGGCGACAGCGTC
GTTCACATTGACATTCGTGACGCCTTCGCCGACAGCGACGACAACGCCGACTAAAGACACATTGGAAGACAGATACAAACGCAGTCAGAATCACTTCGAG
CCATTGCTGTGTACCAGCACATTGTGCATACACCAACAAGCACGTACCGGCCTCGAGACCGCAGCCGAACGGCAGCGCTGTGTTGCCGTAGCCGCCGTTG
GTGACGTTCACGTCCGTGGCATTGATGCCAACGTAGTGATTCTTGACGACGACGTTGCCGGCGCTCGGGCTCGGCAGCTCCGGCACGGTCACGATCTCGG
TCGCCTTGCGGAAGTCACTCGAGAACTCCTTCACTTGCACGGAGCGGTATGACGGCATGCTGCTGACTGGGTCTGGTGGTGATGCTGTGGTAAAATGCAC
AATGCGATCTGCCATCGCGTCTGCATGTCGACATGATTTTCGACAGCATTGAAGTCGAAAATAGGAACAAGTTTGATGACGAAAGCAAAGGCGCTCCCGT
AATGCAAGTGTCCCAATCACGAAGCGCGTTAGCGCATTGGTGGCGCTCGCGATCCAGCAGCTTCATGAACAACGAGCGCGGGTTGCCCCGATGCGCTGGA
CTTGCGCAGACGCACTCAGCACGTCGACACACACGAGGTAAGACACTCGAGCAGTATGCAGCTTGGGCTCTCATGGTGTTGCTCGCGACCATGATCAGAC
GGTTTGGATCACGAGGCTCATCGATCAGCAAGAGCATAGTCGACGGGGGCGCCACCTGCTGGTGCGCTGAGTGCTCGTGATAAGTACATGTATGCAAGGT
GATGGATATGCAGCGCGCACATTATTTGCGTTAGAACTGGAGCATGTGTAGCCATGTCCGTACATGGCTATAGCTCAATGCCACCGCTTCGGAAAGTTCG
ATCAAAACGAAGGGGATGTATTATTCAGTTGGTTTTACAGTAATTTACCTTTCGGGCAATCATCATCATGTCGTACAGTCTGCATTTACGCGAGCTTGAC
CACGAGCTTGCCGATGTTCTGCTTGGCGTACATGCGGTCGATGGCGTCGGCGATGCCCTCGAGGCCGTTGAACTCGGTCGGGTCGATGCCGGACTTGAGC
TTGCCCTCCTTGATGAGTGCGAGCAGCTTGGCGATGTGCTCCGGGATGTGGGGCGCGTGGTTAAAGAGGAGGAAGCCGCGCACCGAGGCCGACTTCATGA
GCAGCTTCGTGTTGAGCTGCGCCGCAAGGAGCGGGTTCTCGACCGTGGCGCCGCGGTAGCCCGAGATCATGCCAAAGACGATGATGCGCGCGTGGAGCGC
AATGTTGTCGAGGATGGTCTTGAAGACGTCGCCGCCGACACTCTCGAACACGAGGTCAATGCCCTTTGGGTACTCGTTCTTGAGCACCGTCCCAATGTCC
TCCTTGGCGTAGTTGATCACGCGGTCACAACCGAGCGACTTGAGGTACTCGACCTTGTCATCCGACGAGCACGTGCCAATGATGTGGTTGCCCGCAAGCT
TGGCGAGCTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTGCCCATCTGGCCGACCTTCTCGAGCGCGAGCGACGCCGAGATGCCGCACACGGTGA
GCGGCACCACGACCGGCGACACCTCTGGGAGCTTGATCAGCGACGTCGCTGGCACTTCCACGTACTCGGCGAATGCACCAAGCTCTATGCACACACCAGG
ATGATACAACACACCGGTTAGCATTGATAAGAACGACACACACTATCAATAACTCTAATACGCACTCTGGTAGGCGACCGCGTCGTTTACCGCGACCGTG
GAAATGCCTTCACCGACGGCGAAGACGACGCCGGCGCCCTCGAGGCCGGGCGTGGGTGTGGCGCCGTACGCGCCGTTGGTGACGTTGATGTCCGTGGCGT
TGATGCCAACGTAGTGGTTCTTGACGATGACGTGGCCGGCGCTGGGTGTCGGGATCTTGGCCACCTCGACGACCTTGGTGGCCTTGCGGAAGTCCGTGGA
CGGCGTCGTGATCTGGAGTGCGCGGAAGGACGGCATCTTCTTAATGACTGGCTCGTGGCGAAGTGAGCTCTTGGTGGCGAATGGGCGAATGAATGTACAA
CAGGGCTGCTTCAACTGGAAAACGGGTCGGGTTTGATGATAAAAAACGGGTTTGACAGCGTTTTGACTGATGAATGTATGCTCAAGTGAGCCCATGGGTT
TTTGTTTACGGGCGTTACGTAAGTTGGTGTGTGGCTTACGTACGTGGCGGTGTTGACGTTCGACTGGAGGGTTTTGATCGAGTCAACACGACAAGAATAG
AGAGACCGGATAATAAGGTTAGACAAAGAAATGGGACAAAGAGCAAGGCAGGAGACATCTTCATGTGCTGCGCATGTGCAGTCTGTAGCTATTGGCGACT
GGCGAAGAGCGCCCCGAAATCTTTCTTCATGTGAGCTCATGAAGTGAGTGTACAGTCTGTACTGGGCTCGTTGGGTTTTGTGCACGGATTTGTTATACAA
AGTGAATGATATAATGAATTATTGAAGGTGTACTCACTTTAAAAATTATTTTCTTTTCAAATATAGTATAATCGGTTTTGAAAGGATATTAGTTCTAGTG
ACATGCTAGTATTGTGAAGCCATTTCAATTTTTTTTGACTGTCCAAAAAGACAACAAAAATCTGAAGCCACTTGGCGACGAAGATGGGAAGATAGAATGA
TGGCTTCAGAAGAGCACACCAAGCGGACACAACCGCACACAAAGAGACACGTGGCGTTGCCATGAGAGCGCTCTGAACTCGGCAAATCTCCACAGAATGC
GCCAACCACAAGTAATGTGTACACCAAGAGGAAGTGAGAAGCCAAACACACCAACACCAGCGTCGACCTGTCGCCAGTCGGCCAGGGAGCGAATCAAAGC
CTCGAACAGCGCACGTGCTTGGCTGGCGCATGCCTTTCATGGAAGCTGCTTCGAAGCGTCCGTCCTCATCGGATAAATGGGACACTCGACGTCGCGCGTC
AGTGACGAGTTGATCCGCCCAATCCAAACTTCAGCTTCGCGAGTTCTCTTTTTGTTGCTTCGGCTGGTGGCCAATTTGCAACCCACGACCTAATTAAATC
AAGCACTGGGATGCTCATCGCAGGTATGTAGGGTTTTGACTTGATTTCACTATACCACATGCCAAAAAATTGTATCAGTTGGTGCCTTCAGTTTCTGTGT
GGTGTCCCACCCATCCCCCATCATAGTGGAGCCACCTGAATTATTTGGCTGGGATTCCTCTGCGACGTGTGCACACTTGAAGTTTGTATGCACAACTGTC
AAACAACCCGGAAAAACGCAAGCCCAATTTTTTTTTGAAGAGCTCATTAAGCTCCAGAGTCCCATTCGCGCCCGAGGAGCGCAGTCACATCGCCCAAGCC
CCCACTGAGTGCGCATGCTGCTGCCACAAGGCGGACCGCTGGAGCTGCCGCGCAGCGTGCTGGGAGTGCTGCTCGAGTTCGCCGACCACCGCAGCGTGCA
CCAGCTCGAGGCCACGAGCCGCCACGCGAGCGCGCTCATCCGTGCCACTGGTATGGTTGCATGTGTTTGCTACTGTGCAAGGGCATGTGTATTGCAATGC
TGTTTTCTTATATGTGTGTATGTGTGTGTGGCAGGCTTCTGGCGCACGACAGCGCTCAAGCGCATGGCGCTGCACGTGCACAGCGAGCATGACACTGGTG
CTGGCTGGAAGCGGCTCGTGTGCATGGCCACGATCCCGACCCAGCGCGATCGCAACCTACTGCAAGACGTCTATGGTGCGCTACTGTGCTAGCCCAGCTG
GCTTAGCCTTGAAATACTAACGGCTGTGTTTCTGAATGAACTGCAGGCTGCTCATCGATCGACCGGCCGAGTGAGTCGCCGTCCAACACGCTCGTGCCGT
CACGTTGCTGGCTCTCGATGCAACGCGCGCTGTCGCTCACGAGTCGGTTGCTGTCGCCAGACCCGAGCGCGCTGCAGAACCTGGCGAACGAGGCCCAAAT
CGAGTGCGGCTGCGAGACCGCGGCGTGCTATTGGAGCTCCTCGCCGTCACCGGCCAAGAGCTCGAGGGACTTTATCGAGTACACGACGCGCACCAACTGC
CTCGTGTCCGCGATCCAAGTGCTGCCGTACCGGGCGTTCTGGCATCCAGACAGCCCGACGTTTGCGCCGCAGAGCGTCTCGTTCGAGTTCTTTGCACGAC
AGCGGCAGGACGTCGGTGGGGATCGCAGCTGCAGGTTCCACGCCAGCTACAAGAGCAATCAGATGGACGTCGATGATGACAGTAACAGCGACATGGCCGC
GATGCTCGACAAGGTTAAGATCTACGAGTCGCCCGTGTACGCAATGCACAACGCGATGCAACTGCACGAGTTTGCGCTGCCCAAGAAGGTTTGGCTCGCG
CAGGGCGGCACGTTCCGACTCAACCTGCTGGGCCGGTACCAGCGAGAGACCTTTGAGATGCCGCCGTGGATCCCCGCGGACGAACAGGAGCCCGCCGAGC
CGCCCTACTACTGCTGCCTCAGCTTCGTCAACGCCGTTGGCGTGTCTTACGACTACCGGTAGCTTTAGGACACACAGCAAGCC