Description :
From Genome Similarity Track
Location :
Scaffold_93:157539- 159612
Sequence
2073 bases(100 bases per row)
AAAATCGCAGTCGGAGTCCGGTAGCTAGGACGCTCGACCAGCGGTCCAGACTCTTCAACTTCCGCTTCTTTGCATCTCCAGTGTCCACAGCTGCTTCGAA
CTCAAGTGTTTGCCGCTCCCGATAGCGGTTTGAATCCTTCCTAGCGAATCCAGGTCGACGCGGGATCTGCCCAACGGGTAACCAGATTGCCAAACACACC
AAACGATCCAGTACCAGGCGGCTCGTGCTGATGTTGGTGATCCGGAGGTATGACTTGTTACTGAATCCACCATTCACCACCGTGATCACCCATTTTTCCC
CTCTCGTTACCCACAGTTCAAACCGCTTGTTGTGGGACTTGAGTGAGATCTCTGTCCATTGGCCAGGACCGACTTCATGGAATCCCGTTGCGTAGACCGC
GTCAGCCTTGCTGCTATACAGTGGCTTACGGTCGGTCATCTGGATGCGAAGTTCGTCCGGCAGACAGAGCGTTCCGTCAACCAGGTCCAACCTCACCCCC
GCTGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCACACACGGAACTTGTACACCAACTCTCCAGCCAGAGTGAGCT
TGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCACACCAACACAATCCATTGTTTGTGTTGTATCAATTTCACAACCCACCTTACGTGCAAA
GGTAGAGTCGATTATCGACACTTCGGCTCCAGTATCAAAGAGTAGGACGGCACGGACATTGTTGACCGCACCGGTCGCCTTCGACTGCTTGAACCACTTG
GAGGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTCGAAGGGCCATCACACAAGGGCGACGCGAATAGTCATCTTCATCCGAGGTAA
GAGATCTGGCTGTATTCACCGCATGACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTCCTCTGAACATATGCATAAATGCAGAACTTCGATCGCTCGTC
ACGTACCAGGCTGTTCAGGCCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGGGCAGCAGTCCGGCATGGCGAGTCGGGTTGTACCATTGGC
GAACAGCATCGAAGAAGTCGCCGATTTTACACTGACCTGCTTCGTGAACGTCTCCACAGTACTTTCAGACGTAGAAGCACTTGTCGGTAGGATGGCCCAT
GCGTCCACACTTCTGGCACGTGAGCCTCTTCCAGCACCCGAGATCCGTATGCTAGCGAGATCCGCAGTGTGAGCATCGAGTGCCGTACTTCGGACGCCCC
AGTTGGTCTTCGCGGTCTTGGCGCGCCCCTGGCTGTTCACCATCTCCTGGTGTAGGCGTCCTAGCTGCCGAAAACACGTGCGCTCTTTCGTCTTCAGATT
CGCTATCGGAACTGCTTGATTCGCCCTCGAACTCGTTGAGATCTCCGTGATCTCCGCGGCGTCCGCGACCGGTAGTCACAACCCGCACCGCCCTCGAGGA
GGCTGCAGGGGCGGGAGCCTTTTGGCGGTATTTCGAACCTAAGGGTCTCAATCTTGCGACGTTGGTGGCGGCGTCGCATGGCCAACACGACGCCTTCGAG
AGCTTCTGAGTCAGGCAGCCTCAACACTACCAGAGATCCGGCGAGATCGTCATCTTGGACTGTATCGATGTAGTGGTCGACGTGTTCGCGTCGTTGTTCC
TTGGTGCCATCATGGATCTTCAAGTTTGCACGTATCCCGGCCAGATTCAGCCGGTATAAGTAATCCAGTGGGTCTTCCTGACTCCCGCGCCGCATGTGGT
AGTACTTGCGCGCGAGGGAGATCCCTTTACCGCAAAAGTGGATCTGGAACTATTCACCCAGGTCAGTCCACGACACGCGAGCGGTGCGGCTCAGCTGGTA
ATACCAATTGCGCGCAGGGCCTATCATCAAATCGGCAAATGTCAAGCACATCTCGTCTGGCTGCATCTGATCCCGTCGGAAGGCCGTTCTAACCTTGTTG
AACCAGGCTCAGGCGGCTTCTTCGTCATGTTCCTTGCCGCTGAAGTCCTTCAATTCGGACACAGCCGATGCTC