Description :
From Genome Similarity Track
Location :
Scaffold_327:15751- 19163
Sequence
3412 bases(100 bases per row)
AAGATTCTAGCTGGTGTTTATACGAAGATTAATCCACCAGCGGTTCGGTGGTTCCAACGGCGATTCCTCTTCACGATATTTGGTTGCTTCACAGGCGAGA
GTTTGCCACTCATTGTACCTTCGCGATCCCACCGACACGTATACTGGCGATCTGGGTATCATATCAGTATTCATCCACCAGCCTAAAGAGGCTCCAGGAT
TTACAATCACCTTTCGATCCACGATATTGGTAAGCTGCAAAATTTTCTTCGGCCTAATTCTGTAGTTACTGTTGGTACCCAAATTCTTCCCGTCTAATCC
ATATCTTGGCCTTGGGCGCAACCATATTGATCCGTACTTCGTCGATCCACCCACTAGGATTTTCACATGATGATCATAGTTCATTGTTATCGGTTGCATT
ATCGATCAATATGTAGGTCTCCTCCCAGGTAAGAGTATTTTAACTTATCCAGTAGGCGAAAAAGTCCATCCACTAGATCCAAGCGTACTCCAGCAGAGAC
CATACAATTCACCCACAATATCGATTCCTGGCTAACTTGATCGCCTACCAAGGCATCGAACTAATATACCAGCGATCCGTTCGACGAGATCTTGATCTTG
GTACGTCCCACATTCGTGTATATATTCTCAATAGATCCCACAAATTGTTGCCTCTGACTCTCGTCGATGACGCAACCTACCTTACGAGTAAGAGTGGTAT
CGACAATTTGAGACTTTAACTCCTGAGTCCAAAAGAAACGTAGTATTTTCGTTGTTGGTATTTCCATTGCCTTGGCCTGTTTTAACCATAATCCAGGGGT
GTGAGACCCTCAACATCCACGTGATACACCCGGGAATAAGTCAAGTGCCATCTCGGTGGGCGATATCACATACTTATCCGCCCGTTTAACACTTGATATG
GAAATTATATAATCAGGGCCAAATTATGTGTATTAGCAATCAGATTGATCTGACTGTCCGCATCTCGACCCTTCCAACTTCTTTCAACAAATGCATAAAT
GCAGAGCCTAAAACGCTTGACTCGCGCCAGATTCCATCCTAGCGTCCTAGTTTAATATTCTCTCCACCTTGGGCGGAAACATTCCAGCATGCTTGGGGCA
CATACCACTTGCAGATGAAATTGTAAAAAGCTACCATCGAGCATATGCCAAATGTGGTCCCATGCGTCCACATTTCTGGTAGGTCAATCTCTTCCAGAAC
CCTCAATCACCGTGTTTGGTCAATCCACAATGGGTGCACGCTCTCCATTGTTCACCTCGTCGTGATCGTCCTCCCAACCGGCATCTCTCTGCCAAGTACG
ATGATCTTTGTCCGATTTCACCTTATTGGATGTAGCTATCACACTAACTCTACGACATTTCACTTCCTCATCTAATCCACTTGATTCCAAATCTGATTCG
CTACTTTCACTCTTTTTATTGGATCGCTCGTACCGCTCGAGCAGTCTTTAACGACCATCGGATTCGGAGACACGACTATCCGCTGATGAAACTTGCCTGA
TTCCATCGACGCTTTCATCTATAGAGTATGCATCCGCTGGTAAGCACGCGGAGTTCCCTCCATCTCATCTTCGTCCGGTACGCTCAGTAGAGTCAGTTGA
TTGGCCAGATTGCAATCGTCTAATGTCGCAATGAATTTTTTTTCCGTATGGTTCCGACGTGTAGCTGATGTAGCCGAATTTCCTTCAAGTTGCGCGATAT
TGGTCTGTATAGCTGCAGCGTTAAGGCGGTATAGATACTTCAAAGGAGTCTCGTCCGATCGCATCCCTGTGTGGTAATATGCTCTGGCCACTGACACACC
CATGTCCGCTGACTGTACCAGTAAACATTCCAGCAACGGCTTCCATTTACGCCGGGTAGATAGTGTCAGCTGACTTTACCGGTTCTGCACCGGTGGTGTT
AGCAGATCGCCAAACACTATCCACTTTTCTTTAACGGTGTTTGATCGCTCAGAAATGCCGACTTGACTTTTCTGATACACCTTCGGGACCGATCTTCATA
TCTGTCTTTGCCGCTGAATTCCTTTTCAACAAGTACACGCTAGAGAATTGTATCACCATTCTACAACGTTTCGTGATGGCTACCAACGCACGACTACGAT
CCTCCTGCCTCGAATCGTCAGGATTGCCATATTCAGGATCGTAAATTTCAGATCGACCGAGATGCAATCCGACCGATTCTATCTCGATATCTCTGATGTA
TGCTTCTCTAACTCTGAATCCTTGATGATGTTTTTTGTATAGATCGCTTGACGGGCTTGCTCTCGTTGTTCTTGTGGGAATCATTCCATAGTCATGTCGA
AGCAGGAATTCTAATGTCCTTGGCTAGGAATCGTCTTTTTGTTAGCGCGTACAGCTGTCGATCGCGGTTCGGTCTTGATTCGATCAGCTATATCTCTTAG
ATGTACTATCCCACTTGGACCTAAGGACATGCGCTGAATGCCGATCGAGTCGTCCGGTTCAATCTCGAATTCAGCTGATGCATACTGTGACGATCTGGTG
TGTTATCCTCTCAGAATGTCTGCTATCTCTGTGTCCACTTGGTCAGCGGAATAACATTCGCCTGTAGGGGAAATTTAATTTTGACAGAGCGATCGACTCA
CGTCGATCACCTTACTCTTATCATACTCCAGCAAACTTTTTAGGTTGAATGGTCCTGCAAAAGACCCCGTACTCACTTAGCAGCTCGATAATTCTATTAG
CCCCTATGTGTATTCAACGCTGCAGCTGGGGATGATACATTATCTTGGATCGTGCCGCTCAACTTGGGCTTCATGATGAGTAGCACTAAATCGCTCGCTA
TCAACTTCTTGAGCATCTTTCAGTGAAGCTCCTTCGTCAACCCGTTTAGTTACCAATTGTCCATCTTCACATCATTCTCTACAAACTCTATCGGTCGAAC
GATCGATTTTGTAGCGCGACCGTGTTCATGTGATCCTAGTGCTTCATTATTCTTCATTCGCCCTGTCTTCAGATCTTTTGTCTTTGAAGCTTTTGGAGTG
GTCTTGGATGAATTCATTTCGGTTGTATCCGAGTGGTTTTCACCCATCGCATCATGCTTTGCAGCACGATACGCGGTGGTCTCCGGAGAGACCTCAGGAG
AAGTCGAGGTTTTTCTTATCGAGGATCGATCGTCCTCTCTAATTTGCGTGTCATCAGAGCCCTTCATAAAACTCTAGTAATCCGGGGATCATATAAAATC
ACGCGTCTACGGTGATACTCGGCCTCTGGCGCTTCCATTCCAGGCTTCATATTTATCTTCTCATCTTCACTCCGGGACCCACGGTGAAATCCTGTGTCAC
CATCAGATCCAGGCCAGCGCACCAGTGGGGAGCGGCGACCCCTCACTGTCTGATGCGATCCAAACCTTCTAGTGGCAATCAGATGACTGACTATGGGAGG
GTGTATTATATT