Description :
From Genome Similarity Track
Location :
Scaffold_4:157509- 193952
Transcript NameFunction/comments
Phyca_LT1534503507polyribonucleotide nucleotidyltransferase putative
Phyca_LT1534503508pre-mRNA-splicing factor SF2-like protein
Phyca_LT1534559795ribosomal protein L38
Phyca_LT1534503511TRAF-interacting protein
Phyca_LT1534100075Hypothetical protein
Phyca_LT1534100260Hypothetical protein
Phyca_LT153474777Hypothetical protein
Phyca_LT1534503513ATPase
Phyca_LT1534503516kinesinlike protein putative
Phyca_LT1534539844aspartate aminotransferase, putative
Phyca_LT1534503521protein kinase putative
Phyca_LT153482718Hypothetical protein
Phyca_LT153413524nipped-B-like protein

Sequence
36443 bases(100 bases per row)
aagtggtggggaaatgagtaccggcatcgttactcctgtcgatgtcgcggttgccgtcaaagaagactcccagttcatacacatttaaacatgtgcaaac
atgccgaggtagattcaagaaggagcttcctgtgacgttaaaacctgagtggacttcatattggacggacgatcgtcgcgtctacccacgaccacccgcc
aaagaaccgtcttccgtgggtacatgtaatatctgcctaccgataacgcttctctttcagcttattgcgtggatcatcgtggccccgttcatgcttattg
cctacatcgcaagtggcatcaagactttcgtggtgtcatgcaaacttgataaagaagatcccgttgtgaccaggtctcagttctactgctggatgaaacg
aaatggatttacgaaggaagaaatcaagaaggcgaagaaagcgatagtagaaatgcagatacagatgcatggaattgcccacaaactgacggacgtgcgt
gcggtggaggaaacactgaagttgcagtccatcgagaagcagaaaagggtggttggaatgctccagcgatctatggcagcgatcgataaaaggcacgcaa
aacagttcgagagacttcgggatagatatattggtgcgatcttctgctggggctcgcaaggtgcttacaaacttggtgatgtggtcgccaagaacggccg
atggttcggtcgaggcgaaggcgatcgcaagaaagcagactgggaacagaaggttgccactaaagtcgacctgcgagccaacgccattgtgcgctgcatt
aacacaatggtcaatgatgacttttacgactgtacgggctccagaatgagcgacttggagcggaccatcaacaagactaaacggggacagcaattgattt
ggcacgactttgtgcgcagaaacaaattgcaccacaacaacttgctcgaagaaatccacactgcagcgccgttcatcaagcagtatatcactcacgccat
tgttacggaatcatattgccagcggattacacgcctcttctgggcttggttcctgctgctgcttgtcgttgcatttaaacttgccaagttgatagtgaag
catgatatcagcgatgttgccgatattctcgacctcattgtcggttcaatcactagtgtcgttgaagccccagcagcgctagtggatatgcttgaaaatg
ggttgccgacagatatcgggagtattgaatctggtcttggatctgactttgggatggactcgttgaaccagaaacgcttggacaatagggaggctcgtct
tgacaaccacctagatgcgattcaacactccacgaaacatgaagagataaacgaaatccccgacgatacgattaccatttcgacagaggaaaagcgtaag
actcagcagtaaggggctgcattcatatgataatgcattctacactttagttgcttttaagttccattgtttttctggttatcaagtgaactttaacaca
agaagaaggggatatcctcaccttcttcagcagtgactacctattttgactgagtacgcgggcggcgtgtagtcttgggacggcgttttgccccaccaga
agctgatgacgatcgacgtgcgtggtggtggccagcacgcggagtcgtgggctcagaattctcggaggaatccgttgaggcttcctcgttatcacccgaa
cccagcagcacacggcgcgacatcttgccggaagctccgtcctgcagacactcgaactccatctcctgtccctccgatactacgtcgtggatgtcgctga
tcttgtcgcgcgatagttccgaaatgtgtacgaaaccacgttggccatccgccgactctaggatagctccaaaatccatgatctgtgtgacacgcatggt
gtagcgctcacccttgcggaagaagaacgaccggctcttgttggagttcgaattctgctggtcattgtcacgattgttgccgttgccgtctccactgtta
ttgtgtttgttcgcaacagcagccaattcggtctgcagccattccttagtcttctcggcgtcatcagctgcaccaacgacacgaacgatgccctcacgac
ggtcaacaaagctcacggaaacgttgaagcgcgattgcaggtcacgaatgttgctgcctcccacaccaattagagcgccgatcaggttcgtcggaatgac
gcactcaagactcacgttaggcagcgcgctgccaccgttctttaaactcgtgcgaggctcagcgagctcgttactcatgcgacgtagcacatgtagacgg
gcatgcttagcttcacgtagtccctccttcagaactgaaagcggcacgccgccaggaagcttcacatccaattgcatcgctgtcacacccgaggtggttc
ctgccaccttaaagtccatgtcaccgtagtggtcctccgatccaagaatgtctgtaatcaactggtaatcgccctcctcaatttgcttctcctggccagc
aaatggatcaccagaagtaacaagaccaatggcgatacctgcaacagcacggcgaacaggaacaccggcatccataagagcaagcgagacgccacatacc
gtagccatggacgatgatccatctgagcccaccacctccgaagtcatgcggacagtgtagggaaattcagtgatagatgggagaataggcagcacagctt
tctcagccaatgcaccatggccgatcatacgtcggttagtgccaccaacgcgaccggtttcattcacacagaacggagggaactcatagtgcagcatagc
attcttaatctgcgcagcttcatccagttcacgagcttcgttcaatgcaccacgaaggcggataccacgttccagcggccccagcgtcacggagcatagc
gtttgcgtctcaccacgagcgaaaagggaagatccatgagccatgggcagaatacttgcctccatctccagcggacgcacaacacgaaccgatcggccgt
cgagtcgtacgcgtttgttcttctgagccgtcttcgctacagccaaaatactatcacgcagcacacgctggaacgtatcgtgggctgcacgctggatagc
tgcatcgtccaccggaggatccgcagaagcaaagtgatgacgcataccgctaagcatcttattgtatacttcgcgctctccctgctgccggtcgagttta
ccgacacgacagctagcaatcaacgcctccgcgtcggcacgaccaagctcttcagccttggcccagacttcctgcggaatgaacattggcgaaaacgcac
gcttctccttgccatgctcagctgccagctttttctgctcctcaatcaccggcagtacattagcgtgcgccagatccaacgcctcatcgagacgcgcctc
cgtcacttcgtcacccgaggcttccaccataatggcacgctccgctgtgcccgcatatagcacatccagcgtcgcagcttcgcgttgtggggcagtaggg
ttgaccaccaattggccatccacctccacgacacgcacacagccaaccggtccgttccacgggatatcagacatgctcagcactgcggacgccgagttaa
cggccaccacaagaggatcattgttaggatcatacgactgcacagttgccagcacctgcgtattctcgcaaaagtcacgtggaaaaagaggacggattgc
acgatcaaccacacgggattgcagcacttcttcatcattgccggtgtactcccgtcgcttctggttgtccggaatcagaccaacagcataagatttgaca
cggaagtccactgtgagcggaaggaaatcattgtgacttgagtttccactggctgatgggtttccgttgtggtctccactcacagcagtcgttagcagca
ccgtccggccacatgaggccagtacagctccatctgcaagcttggcgagtttacccacagcgtacgacgtggtatctaagcttccaattacacgatcctt
ctctttcttggactgttttgtctgagtctgatcctctaccgtctcttcagtcttcagcgacgtcttatcaactttatgttcttcattcgacggcttgtca
ctgccgaacaaccaatcacgaagcccaaagaacgcacgagactgtggcgcagcgccagccacacgaggagctcgctgatgagctgtagatataatgatac
gacgcgtcacagccgcgcgtggaagacgacgagccgcacttgatagcatctttggtcgtctatgactggaatgtgcggcagtgctggcgagtcaatgatc
tggtgtaaagaacaccaaccagccgaccactcgatcagaaatagattatgaatattgaccaatagaaacgactagacctcttcagctgttcttcctggtc
acaaaccgaagagctccagtccgcaccaagcaacgctaggcgcagacctcgttccccccttcttcccaggcctttttaaccagaacaacatgggcactcg
tgtgtatgtgggcggactcccgcgcgacgccacgtctcgcgagatccaggacggctttaaccgctacggacacgtcgctaacatctgggtggcgcgcaac
ccgccgggcttcgctttcgtggtgagttgagctgcttcttccgtcttctggcacaagcttcgctcgcatgatggcgcgtttcctccctctccctcccttg
tattcgtctctgtgtccaagcaggagtgcagaggtcatttttggtggcaagttgtgtgttaattgtatgtttgtatactatacatttgtgtatacatgtg
ccacttgacctgctgcaagctccttccgggatccattctgctgcttcttctatggggactggcacgtccttctattggagagggagatagagaagtctcc
tattatgggtacgcaacgcacgtgccatcatgcgtctcgcctcgcttcgtgctgccagcatctgcatcatcttcttcgtctgccgatccgaaccatacca
accaacgcctctccatcgtcgtcctccccatttcctgcctctccacctcttctaggacttcgaagacccgcgtgacgctgatgatgccattcgctctatg
gacggccgtgacttccttggtggacggtaagacctgataatggaatattttgctattgcgttgatgtctaacatattgtatattccgtgttgttttcgcc
cagcattcgcgtcgaacttgctcgtggtggcaaccgccgtgaaggtggtggccgtcgtggtggtgacgatgatcgctacggacgtggtggcggtggtggc
gaccgtttcgaacgtagttagttgttattttggattgtttcctatgatctgtacctaacgtttttgttgttgctgtgctcttaggtcgcaacccgcctca
gcgcactgactaccgtgtgcgcgtgacggacctgccccgtgatgtggactggcgtaacgtaaaggacttcctccgcacgggtggcgaagtcacctactgc
aacattgaggctgatggctctgcgtaagtactgtgatcatattctagattgtaccttgaggcactaaactgacttgttgcattggtgttgctatccgtga
tgtagcatcgctgagttccagaccaaggcggacatggaggacgctgtgaagaagctggacgacacggagttccgtggaagttatgtgcgcgttgcccctg
agggagactcaaaccgccgctcgcgctctcgttcgcctgctcgtggtcgttcgccgaaccgccgctcgcgttcgcgttcgcctgaagcgcgtaaggactc
cccgcgtcgttctcgctccagatcggcctcgcctgctgctcgctcgcccgaacgcaagaactcggcttaaactgatgtggactgaaggtggagagcatgc
tcattcgtcacgaagatggtccatgactattgacgttgcaggtcatccagcttgtttgctgccgaacgtcgaaggtgtaagcacgttaacgatggcaaaa
cttcctgtgttaacctgttttaccactggtgctgtacaatgagttcatactcacttctttttgaactgacacgcttctcgctagtcactcttgagactga
cagctcgtgatacataccaaagttgagtagctatatgtataccaattgcccggattacagtacacgacaccaagctcggtatcttcggagtttgaggata
cctgcactgctgcctaagtagcaaaagcgcgtgaagaaggacaatcaaactcctgtaacgtcctgaatcacgaatcagaacaaatacgatacgagcgaca
gaaccaactggttttgtccaactaaaagcgatagaccctgtggatgaaggtgatgatatttgtgtgtcgcccctggttcccctgcgtccggccgtcgaat
gagcgagcggagtaaaggaggaagctgttacgagaaacacccctgctgtgccctgcaggccagtcctccgctgatcttcatctgcatcgaacctatcacc
tgcccccaacgctgaaaaagcttaagaagaccgagctttattatgcgccgcacttgcacattgccacacctaaatatccttgcgctggagtcctgtatca
cacggaaaaagcaggaaaacctagatcagtacctgacattcctgagctgctaacagctgaaaacgggcataccagggggcagggactgcgtgagcttgtc
cgccttctccgtgtccgtcacgcacagcgtgtacaggtacttcgagcagcggattttgaacttgacgaccttgtcgctctttttgatcttgaccgagcgc
gcatcttttcggcgcgccttctgcaggaagtcacggatgtcggtgatctgcttcggctgtgtatggcgcaagtcaaggcacgacacgttagcatcctctg
cactttgtgatccctgtgggctgttctatcggacgtatcaaaagccacggccgcgtaccattttgttgcgttggtcttctaaacttaactaagaagcact
ggcagagcctacaacaggcggaggctgtgcaccatacaaagcgcctgtcacggtcatcgattggcggcggcgggctcaaaaagtgggctttttacggaac
tttttacgactttttgaagtaattacgctttggtgtacaaacacttcatgtttcagaatttcagttggtgtcacgttcgtttttctctcacttgatttca
gtatggcaaaggtcatttcaagtcggtaaaacgccccatacatttgagatcgaaggaatggcgacatcctcgagccaggaatgccacatctgtctggagg
agctacgacgtgacctggtggctgctccgtgcggccatgtctaccaccacatctgcatcattcaagctctacaggtcaactcccagtgccccatttgccg
cggccgaactcgagaaaccgaccttattacgctttatttcgatgtaccgaatgcgaatgaagcgccagaaggaaacttacagcttcccaaggcgtccgga
gacaatgtggcgctgagttcgcgaatcaacacgctcatggagcgcatccagtggcagaacaagcagcaggagcgacttgtagacgagctgaggcgccttc
gcagtcagagcgagcagctattggctgataaacagacactggcacagcgtgtagggagtttacaggctggaaagaatgagctattgaacaaagtggcgag
ataccagttggaactgtcacgtcaaacggaagctgtgcggagatccaatgtgaaccagagcatcattaattttctagagacatgtgacgcctctgctttg
gaggaggagattcaaaaccctcgagaacttattatggcgcttaagaaagcttgcaagttccgacatgaccagtatcaaaaggtggtgaaggagaaacacg
actcaaagagatgctgtacaataaacagtcacaaactgcgcagcaaatgggaaacagcgccagaatggcaaagaataaggctcggagcgttggccccgtg
atatctgaaggaaaacgtgcctacccaagttttggaacgggacttcagccacccgtagagaccaagaaacgtaaagtcgagtcgtcaaccatgttatcaa
gcgggatagatttctttgatcaaggaggcgatagtggcttgggatttacgcctcgctcggagtcggcaggattccgtgcaaacgcctactcggacgtatc
gattcgtccgccacctaatgcaaggcagacatttggacggagtacctacaacccaaaccagtacggggcttttaacatgacaccgtcgagccagccccct
gtacagatggcggaatctcaggctgcagtgtgccgtcgcgggtacgacgaaaccggtaagttgactaactttttcctcccaaaggaagacgattcgcggt
cgatgcctcggaagaagccgattccgagtatgctgaatctgttgaactcacaaccgagagcttcgggtcagcagcaacgcgttagcgatcacgaccgtca
ggaatacgcgctgacgaactggctgcgcaataattaaaggaaggggctatgggacggcggtgtaatggcagactcggggattctaggccagaacaccatg
taaaatactatttgcaacggtagaggctggcacggcttatcgtgctagctcttagatttaaaacaagggatactttgcttgatactttaagtaattattg
ggtcgtgttaccggtattctcctgagagtaattattgggtcgtgttaccggtattctcctgagagccgtggagctggaatcgaagatgtgtcatcgtttc
aagtagagctaaatggtgttcattcacagcttcgatgacctgagcatcgttacaggggaagatcctgtcggacaagagacgacgtccgatttcttcgatg
gagagaaaagaaacatccgcagagtgtacttcttcgtgaggttcgctggagtgttctgggctgttatcacttgtatttgataaaactggtaccagcactt
ttgaacgtcgccttcctagaaaagaagcttctgaacgctccattggcggtggcaacggcgagagttgtctgcagatacagtaacataaagtcgctaagct
gaccagatttgcagctgtcagctttccactgtttttagttccgatgcctacgctccacggctgcaaaatgacgtgtggaatcagaatccgcacgaacaga
aagtttaccataacgatgttaaaccgtgagaaacacttgatttcttgtggagctggctcatcatttctttcgttctctttcatgtcagcctggacatatc
cattaaattccattctccgagttgcaccaagagcattaaattctagacttcgtcgttcctcaaggaacaattggtactattagaagcgtaacaatcggtt
agcagagagtcaagtggcagcagcttttaacgtacactgggtggaaagtaaacaccatcagtcgaaattcttttccagaagtccaacatcccggagggca
cctctttcttgtcaatagcttttcctaaagcctgtaagatccctttcatgcggaccttcagcttcagcagcttcgttggatccacagaactctcacttga
tggatcatttctgagaagaggacgccgagcgaggataccgccaaacttctttgcaaaaccgcgtagagacgacccagcaagacttcttctcgtgctaata
tctacgtctaaagttgaatcttgaaagagagacaacagcggagttttcaccacctttcctagccacaaacgagtagcatcaacgaaaacacgcagcatgg
actcaaagtcctacagatatgcgactggttagtaagttagttcttcgaagtaggagtaataagcataccgtcgtcgcgcttgctttttctgccagttttt
tctccatcaacatatttttgagatagatagtgtgtaagactgctagaacggcagagcggaagacttgaagaggctccatggcctctgcatcctcaacgaa
attcgaaacaccatcgttatcagcctcggcgtctaggcgccatcgtggtctttttaaagcacccccaacagcactcttgagtgaggcactgagtagtgcc
tccaaattcttacggttctcgaaccggtcatgtgctttctggtcttttggcattactgttgtatccgtgttagacatcagtggattattcaccccgctgt
ctggaatatcaagaacatcagcgtcattttcaaacttattgagagtctaagaaacaattatacgttagcagcatagacaagatcgtacgaagtagtagca
tgaataccagttcatcttcatctgtccactcgaagtcagggagccacgagagagtagctgctgggctctgaactgttaaaacagctttctttgttggttc
tttggtcttatttccttgttgtgttgcagtatccgacttctcatcgttaggttttcggtctgatgaaggatcccttgacgcaacaagagatctcaacgat
tgcccagaggtttccgttcgtgttacctttcgagcatccaaaacgtgtgtatcttcactttaggcattggacagtttaggttagctttgcaaacggttgc
caccgatataagacaaggattcttaccgacgggggagaagaagcgccataatttgttcgttttgttctaccaacctctctattaagtcgtcctttgatcc
cggtactcgattgaattgagaggtaagcaatggagaattggtccagggttcgttgctgaaaacagggctaacagctgcttgcccagccaccgtaagctgt
atgcatgtagtgttagacataactgcactagattccgtaattgaatgcttcacagcggacacacctcgtagtggcgcacttgctgctcaaggctctgcac
ttgagcgctacaacacaacacgaaattaaagattacctgcaacacatcatgtagaaatacaaagtaatttgatacttcagttcgtctcggcgttctcttc
gagcatcaatcaactgattgcgacgcatgcgcaacaactcattcatcgaggcttcttggcaaactgatcgtacaacaccttgcttttcaccacgtgccgt
ctatagttttgcatttcgacggcagcagaacggtattcgtgtgttgacatctttttttggctggatctggattagcactgatcaatagcaaacctcgact
gacaggcaccgtgacaatcttgtattcagccattttaaggacaagcagatcagctctctgccgtcgatcgatcctgcttttcatccacattatcaacggc
tttctcgtcagcagcttgctgggctccttctttcttctcttcttgcctctttttgtcttctgcttcctgctccgcaatctcctttttagcagcttcttcc
cgtccaagaaaatcgttcgttaacgactgttgcaggtcctctacttcatgtaaaagctcgagtgatttctcaagaatttgcgtagctgactcgagtgtgt
tcttggatgcttccagagtcatgttggtaaacaacgtacttgctttataagatcccgtttccatcgtggattgaacgcctcggatctacagaacaagcgt
aatcaattgtattagcgtaaaattcccttcgagttgattgagactgcataagtacctggtctgacaaatctcgcactcgttttgaaatatcaccatagcg
gcacttcattttaccgcatatcactggcaaggatgcctctgcatcgctaatatcgaccacaccaggtgtgtgaataccttgtcctgcaagacggtctccc
tcgggtacgtaagtaagtagggatgccttgaatgtgcacattccagtcttcttcaacccgaacagtttcgtctctgactccgggttactcgagggaatta
gttccacaatcatggagtagtgatcatcgtccatacaatcgtcaccgtcatcgtaaaccatgtacttgtaattcagtgtgataggatcgatctgccaccc
acggaaaatgctgcaaaatacatcaagatgagcagaaacaatatcagaaagtgccacgatagagaatcactaaagctcaacaattttacccgagaatagt
agggatttccggctcctctttttcctctggctcttcaagtttatcagcatcttcatcgtcatcctctactctagcttctggcacaccgtccgtcacttcc
agctccacttcaaccttcttctcgatcttggcttcaatggtcacattgtttaaaagacacaagtccaggatatagctagcgacaaggttagtcgaggagt
acaatgctggaatggcctgtaacacttacgctttgccctcctgcatctcccgttcctcatggacacaagctaacgattcgaggttgtcaacaaatgggcc
tggaaagcatgataatatgcaaacaattaatacatttataccaaaatatttatctttcgtgtgatcgccgctcaccttgaaatgccggaattggatcgcg
ggacggaattgggaccaaaccaggaacgtcttcttccagtcgcggacgagggataatcttgatgtcgaccttaggtgcagcttcacacagagagttactg
agggccatggcggccaccgcactcgcgagcaagagcttgccgagcattttacgtggcaattgcaataatgtattttcacaggttccagcaaactgttttc
tttatatttgaatcttaatgctaatacattcaaaatagcaggtcattgaagttttgtcgggagtgatggtaatatgagtctcagtgcggaatccgccggg
tggagagtgaagatgcaggaaggagacacatcgacgattttaaagcgcgtggaggatgtaacggagcttctcgggcgtacagctgaagcctctacggagg
atgtgtcagctttgcacgaactactggaggagcttcaacgcactgtcagtacaattagtttacagagggttctggagctatctggtgtgcagctggcgaa
tgctggagtagagctatacaacgcgcctcgagctgctttgagtattctggcacgggcggagaaaggtagtcagcaagggggcgagcagtgcacaagtttc
ccacggtatttgctggccgtcacgcggttagtagcggcgaagatcatggaactgtctcttagttgttccgaagatggcgagaacagaaaaggagagacca
aaagcgtgcagttcatggatgaatgcgtcgacgttctgcgttcttttgggcgagtgggcatgctaatgttggagagcgcgtcaattgactgtgagaagtg
cgacgaatacttgaagatggcaaaagaagctttttcttcttcgatacagctctggtctcgaattggtctctcccatttaaccaagtttaagcacggattg
gagctggaacatgtcgtggatgatttgtgggatttttgtgccggccgagtgcgagtacttcagttaatgacagatcattccagtaattcgcctgcagatt
ttcgagatatcttatcgtcgctgcatgagctgaaaatgttggttccatataagactgcgtatgtgagcagtctgctggaccttataaagagtgtgagcga
tggatacagccaaacttcctgccatgagttgttaaaagagctcacagaagaagctctgcgtatcggtgactcactagaaagtgatacagacgaacatttc
ccagagaaggcggccgcattcaaacagcatgtgctaggaaatttactgcgttctctgtgtgcaactggagaccttgaccgagcagaaacgtgctaccagc
ttatcccagctaatcaagacccgaaaatgttgctgctaatgagcaaactgtacatcgataacaggcagtttaataaggcgcatcgcttgcttcagctgct
attcgcacaggataacttcgaggattcccttttgggtgctcgtgcgtatgctcaagggctcggcttctccgacagtggtttggatatttaccgagaactt
gccgacaattacggggacgccgaattcgccataaatttggatgtcgcctgcagccttgcctttgttgacgacaaacgatatgaagcgatagatgagctta
agcgtataggaagcgctttgttggaaatgggacggtgcgcacactgaataacggagatatgtctgtcgtacttacttaagtacattatattgtattgcag
gggtgaccaaggtgccgatagaagcaatcacatttttcgagtacgacagaccattttcgatggtcttcaaaatgctgtaaactcaaatctgcacgaggta
ctttacaacgtacgaaagctgctgtaaagtataaactaactcagatgatgcaggactgtttgaagtggggggatgctggcttagcagtggtaacaacagc
acaagataaggcaatgtactcgaggtaggaatgccttcattatttatctacatcgtacttttgaccacgttggtatacgataggatcatgtctcgttcgt
gtctccagctgagtcgtaatgccaaagcgttagactgggctacaagggcgtttgctttggaggcttcaaagcaatctttgtttaatctgttccaagtgac
acttgaggcaaatttggatgcctcagaaggcgaagtagtccggctcatcgagcaactagaagccagagacgattttgaagtcgaggacttgctggctatg
ggaaacgtggcaaacaaacttggccaatcgaggctaaatatccaactgcatattctggacaagctcacgcaaattgatagttgctcggcaacatttcctg
tgggaatagccctgcaaaatgctgctcgacttgtgtttgacaagttcacccagcagcatgctgaacctagtggcaattcttacggcgaaaactttttgac
gtatgccaacatattgctgcagcagtcaaaaagactagacactgtccaccctaaggagaggtttgggccatcttcagttttcgagtggttctttcgaatg
aggtaagcgtaattatatcaattgcctgcatatctatgctttaaagtgcaattaacgaagacgtcctgaccacagctttgacattggccaaagtacagaa
gactccaaatactttaccgtggcggcagctatcgcagaacaatgcgacgtaatatttggagacgattccccactcaagcagagaagccagcaggcagtgc
tggctgcggttagttctgacatgaagaaaattgattcactggatacaaatcagcttttggaggtgctcgaagtgatcaaccggatcgggctcattgaaag
aggagatacatctattgctgctgaagtcatgagctacttggtatgcatatcacggtctctttacaagaatgcacactgataactgtatttcaggtgaggt
caatgattgcggtgaagttgaggctctttgactcggacacgaaggcgatcttagatttgtgcaagaccacgcagtatagtgcttctgagctcattgagat
tggcggtacgcaaccgttaatcctatatgtgatgaattatctgatgtatgcattgctctgtagaactagtggtgtatgcggcaaaattcgctgaagcgtc
taaggtaagacgaattcggttactcctaatagcagtttgtcgtatcataacatttgaccaggttcgggacagctatcagttcttagctggggacattttc
agttacgggtatgagatgcaattgttcagtatggcggatcaattacttacagcgaaaaataccaggcttcaaaagctggcacaagagagctcaatggacc
caggccagttgagctatctgctacgacggcttatcactctggcagaaacgaaggcaaaaacactcgagtggtttgaacagttgattcagttgctggacag
cttggacattgctttttctgaacttgacctggaatggtttgtcgtgaaggcgtggaataccgtaagtaaacgtgtcatgtttgagtttgctttggctgaa
gtactacatgtaatgtgcacgagtagggtatcctctgttaccgcgcaaatgacaccaaaggtgcattgcacttcatgaaacttgctcagattatcatgcg
taagtgagggttcataatgcttttttactttcatactcctcacattggttgtgtagatcacaacaaacccctcgtggacaaaatgggcaatatgctcgat
cagcaataccaggacctgctaagattaagcgtcagttcgacacaagtgaatttcgaggccaatgcctgattacatttagcttaggatatcaggcaccccc
tcaagtgatacaccggtcatgcctcatacacatcagggtgtgagtcgtgactggatagcccaaccatgtgcgtcttcacggcctccatgtaggtttgtaa
agtcggcaattctgttgtctcttcctttttcagaaccttcgaggcccacttgcgttctgcgtactcgcaaatctgctcgggaaatcaagaacgtcagtac
acagcatttcataaacaacagttttagcttacctctttaatatctcgacacgagagctgtggcgacacgactgccaactgcgagagttcctcctctgaaa
gttgtttagcatagctaaaacaatgcacaacgtcagaacgcttgccataattacgcatcttctctgtgtacatgtagtactgtacataccgggcaaacac
tgcgcggcgggtcttctcgtctggtagattgtaacgaattgaaagatcaaaacggctgatcaatgcggcatccaggtcttgcttcctgtaagttcgtcaa
tgtacaccatcacgttaacccaagcaatatttcaaaagaaatacacgaacaagttgaattcgtgcgtaccggttcgtagcacacacaactgtcgtctttt
tggccgaggcaaacccctccaccttttgcagaagaaccgacaaaattcgtcgtgaagcttcgtgcattgtgccgcctgaacggtctccagcaagcgcatc
aatctaccacaaataggcaacgttatgagtacagcgtggttcatgtaagacgctagtgataacgtacctcgtcaatgaaaataatggcgccatcaagctt
ctcacacgcgtcaaagattgccgacattttcttttcactgtccccgtaccacttggacactacactctcgattgggatatgaatcatggggattccagcc
tgctgggcaatgattcgagcgcttaacgtcttgccggtgcctggaggcccttcaaacagtacagcacggggacgattgctttcataacggcaacgagttt
tcagagcaattcgctcgtacaactcagggttttgaagtgccagcaccacagtgtcttctatctcgagttttaccttctcgtatccagcctacacgaagtc
acagcaccaatcttagtgtgaaaaatgctccaaaaaagaacacataatcatggtgtaccagactgtcccaggttaaactgttttcgttctgcgttggctc
gaagacatcaattccaagaccttgcagctgctggatcgcctcttcctgcatccaatttaaaggggtgagaatgattatcagcggcaaagctccactgagg
acatataacgaaccttggaatcaggtggtgcagaggaagcggaggtcagatttctaccccgtccaacaagtgcatttttacgccgttgctcgagatcatg
acggaagaacgcgttcacatttgcatacgagtaaatctccttgtaggctccaacaacagcatcaatctcgccttgcgtcagatactcgtccttatagaaa
acaaactttggcgttgcctgcagggatgtcgtatcacgcaggaactggaacgaaccggacccgttcgtgtacaggtatgtcactgcaggttgttcgtagg
actccaccacagactttttcgtcgagctatccaacggagccggcatcacttcgacagcttgacgggaaccaggtgtcgacgacttttgcagtttcagcaa
gaaccggcctaagatcgcctcctgatcaacaaacggcgggcatgcaaactcaattcgaatcgtcgacactccatttggcgcatggatcctggaaatccca
atcttcttgatgggaaacgccttagggatgcgggtctcggagctcttgagcgtcgtgcggaactccgacacttgttggcggatgatatccacggcctcgg
cgtactcgaaacgctacaaattcagcaacgatttcatcagctaaaagttttctagttttcaagaaaaaaaaacacgtaaccttttcatattttttgtctg
cttccaattgtgcaggactcatagccattccggtagccgcaacaagcgtggcaagtccagccagagctacgaggccattagacgataagtctctggaatc
cgctacagctctaaaagagcgtgcagtctggcaactttgtgtctgagtcgcagaatggcacagcaaggcttcaaccgcaactggaaggcgactagccttc
cccttggtggctgttacggcgcgagagaggagcttcgtcgagagcccacgctgcatcatatatttcagatagtttcctgttttcttctggttcaatcgta
cttattcaagataggtgaatcccctatattcgtataagtacgaacgcctaaatcagtttgcatgcccacattggcaatggccatcaattagatgaggtat
cccaaattcttaggttccgcgaacgaagactttcttgggaggtgagtcacctcccttttcctcatcttcgccttcgcaatgctggcggtaggctgcaagt
tgccgtctcaaagtgctgatagtctgggctttctgggcgaggatctgtcgtccacattaacagattggtaagacgtgttgcaatcgaaacgtctagcagc
acttacctcttctaaacgtgacacgtattgctcgatgctcgctgagtcgtcgttttgaattgctgctaacatagcaccttcctctgtcagtagctctgca
ttttcctatcgtatcaaaataacgctttcacttagctgtaaatgatactttacatgcttactaggcaaagccaaacctgaattgcgctcatgtgtgtgtt
gagcaagctttcttgctcttcgtacaatgtttgaacctgttcgggacacagtcatccattgcttcctctcagtactctctttgcctggaaaaggcaaggt
ataacttaccactccttgccacgcttcttcggggtactcattttcctgaacggggtcaccgccacttttatctaatgacatccgcatcaacaaatattag
ttcgcctcagtattcgccacaatcactcgtttgcaacgtactagaattgcgccgacgattaatgtgaagaatactcaaatcgtcccttaagtcatgatcg
tgagcgtgatgcgatggaatcgtagcgacgtcgttactgccgtcacgagcaaccctcctatacttatcccctttgccttcgtgcaccacttcatcctcgt
cctccacgtactcctcttcgtcatcaaagtctctgtcaatatcgtcgccttcattttgcccagtatacgcgtcatcgccatcaagatctaaaatatacaa
taaagctcaccaaatcagttactcatggccgcattattaccaaagtctcaggtataccttcaaattggacatcttcaacatctacaggatcagaatctgc
aaccccctcgtcaaatgcatccgcagaaacacgtttctctttgacccgatcggcataacgaagagtatttagcgtgtggtcagaagacgacgcacatggc
gagactgctgcgatcatgacagttctacacactcacatggttagatttgattaatgacaatagccacggaggtcgcgtacctcgccttcgcgttgacaaa
cgaatctttcagcacttgagtaagtttgctcgctcggaatggaatgtgggcacctcggccaccgctgtccagtgctctgcaaattaacagagacggatcg
ttcgttaccaagcaatttagctagaccttcagttgagtacatacatacctgaaacattccttcaaggccagcaaacttcgattaatttcggccgattcca
tccgccgctgccgattgtggtttttcgtgtcttcgcctcgttcactcccagcaagatcgatcaatgataacttgccgtgtagccgtcctgatcctttctc
acggagattaatttgacagatgcagtgcgagcgggacgacacatcgttcacttcagtagcatgcgtcgtacggagactgtttcctttgctgatcacctgc
agcagctcctccgtatcctggggttgtacctcctccagatccacaatttgcacttctccagctccatcttcccggatggtcagcacctgtcgatgcagta
gatcttggcaccgtccaccgtaaatctcaaagaagctcacacagatatccaaagggtagccacgtctggcaaattcatcagcttgggcgaatacatcagc
cgcaatttgactctgaatcccttgcatcgtatgcgtcttgccactgcctgtctgtccgtaagcaaacaccgtagcatgacctccatcatggaacacaaac
ttcaccaggggctgagcagtgtacatgtatacactctgattggttgcgttctcgtcaaaggtatggtcaaaattaaaggcgttgctgtccagatacttag
tgataccgtccaccttgagcttgcaatcgtgcacgatagccatggggttgaggcatgtgatggcgtcgtagtcgtgcttcttcacctccttggcgttcac
cggacgcttacgcacacaaatggtgatcttagtgtctattgcctcggcatgcggtcgacttttatccttgttttgctctcggaaggctttaatcatgcgt
tgaaagtccacatcgcccggatgcccgagtttttcgttcatttggctctcccgttcgcgttcgcgtttggccgccgccatggctcgtcgccggtcctctc
gattcttctcgatctcggcaatagcttgcatcgttggtttggcacgtggcggtgcagatggcgtcccacgtccggcgttaggaggccgcgcattattcgc
tcgccaagccatatcggacgtcggttggaagctcctacaaaaagatgttatcagatggctgccaatctgataatatctgagtcagactttcaatcaaata
aaatggctcgacaggtgacggagtcgcccgagatcgaggcggccattgctgccgtacagagcggcgccatgtcgctacgtgaggctgcacgcaagttcga
tgtggcacggaccactttacagcgtcgggtgcagcggcgtgcgtcagaagcctcgggatcagcttcgtccgagactgtagtggaagaggttgtagctcct
gttacagatgctaccacccacagcgataccagcagtgatgatacggcggagtctacagagtctattacagtgaggaatcaagatcgagctactgtcacag
gccataagagatcagcgagtcatttggaggcaattagtcaaggtaaacgacaatgtgcggcgttgtgttgtgaaggaattttaacagaggcgtggtacat
gtaactaggtccaaggaaggtaattaactgcaaaattaggatgctgtgcacggcggcaggaagcgcgctggacgagctgagtaacaagatgatcagggaa
ggcaaatgtatctacaagctgggattagggcagtcgccgtttccagtcccgcaatgtattgttgatgagctgcggtgagtgcttcgtagtgggggttgtt
gctgttgaaactgatgtgtttttgtgtatgcagggccaattcgcatcagagagattatctgcctgttgcaggattgccggagctttgtgatgatatcgca
gcgtgggggacagatcggttgcatattgactactcgagagacgacgttttggtggggccaggcaccaaggagctgctgttcgtgctgcagactgtgtact
atggggacttattgctgcctaacccgagttgtacgagttacgcgccccaggccgctatcgctggaagaaacatgatgtggttgccaacccatgcagagga
ccactttgtacttcgcccagaagtgctggaggctcattgcgctaaggacccaggttggacgttgattctgctttgacctacgagtgctttgctaacgttg
aattttgctctcatcagatgctcctcggattctcattttaaacagtccgtccaatccaactggctgcgcttaccaggcagatgaggtttgtgcagttccc
catgccttaaagtatcgacgatcccaaactaacgtcgttccttatgctatcattgctaatcagctggaggcactagccaaagtcgcgaggaaataccgga
tcctcgtcgtctcggacgaaatctactcggagctgcaccattccggcacacacctatctctttcgaaatactatcctgaaggaaccatcgtttcgggagg
catgagtaaatggtgcggcgcaggtggctggcgcatgggcttttggttattcccgcccagcatggggtggcttcgcagcagtatgctcgtcatggcctcc
gagacgtacacatccgtcgcgtcgcctatccagcatgccgctcgacgagcattcgttctcgagtacgtagtccattcttcatccccgcaagcaggcaacc
aacctcgatacatcgctccaacgtctcaccttcctgtaacttttgctctctgctctctgtagttgtgtcgagctcgcgtcgtacaagcgtaagtgtcaga
aaacgctgcagctcatcggtggctggttcgcctatcagctacagaagatggatgtcgaggttcaagtcccggaggccggcttctatctgttcccatgctt
ccgtcgacaccgcaaagccctcgcattgagaggcattttgactgatgagcagctgtgcgcacatctgttgcaggatacgggcgtggcaatcttaccgggc
tcggctttcggtcgtgcgccagaagagctcttcgcacggctggcgtttgtcgacttcaagggagacctcgcgctctacctcatcgagagcatggtaagtc
tcaggccttttcccccagcaagcaagtgtgcttgtgccaccgaaatcgctgactcctctctttgcttttcgcagcaagacgacccgtctctggaggccat
tgaaggcttcattcagtcggtctgcccgaatcttgacatcgctatgcgcaagttgacggcgtggatggctcttgctcggccgtctgccgcgccagcaaca
accagcaccctcggcgtgacgccgggcgtcggcttctaagcttgatcggagaaaccggtgtctgtcgttgcaaactgccttcgacgcacgaacggagctg
gaatttttaacaccgagcaagttgctttggcgacttgactcaggatcagagtcactgacgtcactggccgtgaaactgcagtctggagccgatttcgtcg
tgacgcgcccccgtttcttgtcaaacatgaagaagatcttattctcgagatatgcagtccacccagcatgccactgcagtgactgcattgaccaacaaag
caaaggccacgctcccaactcactgagatggcgccagtgacgccacgttgagcttccgctttcgggccagggctgacaacttctacatgtaccgttcggt
cgatttgtggcgagaaagtatagcgtaagttagcagccactggcgcaagacactcatatcgttcaagttagaagaaggattccattcaattcaacagaac
ttcatcttgcaggttttgacaatttccgtaggtttcagttccgtcatctctgctcttttttgtgaccaattgtctattcccgtatcattcccctgcaatt
gtccacaaacaaacgttttagagacagccttgcagtctccactctacaaacccaccggacgaccgcaaaagccccaagacgtccccagcgatgcccgcgg
tcgacgagtacccgcgccgcccgcctacggacccgccggcgcgttctcgttccgcggcttcaagcgccagcggccgcaacgtcagcgccacgttccagca
tcaggttcaggtccgaccaggcgccaactccgctacgaacatgcgcgcgtcgtaccaggacccgcagacacaccagaagcgccacagtaacagcaagaag
agctcccacctgcgccactcgctcacgaacctgcaggatgcgccaaactcgggacgttccagcgcgtcttcgtacacttccggttcagtcctgtcgccgc
ctgatcgcagctccaactacctcaatatccacacgacgagtagagatctgagtccacagcatcagttgcatccggagtacccggccgctccaccggcagg
tgacgatatcctcaaggtggagatcccccgctggaaatccaaactcacgacggacagagcagacagagtgcacatccctgcgggagcggatagcgccggg
aactcgccagtgaacagtggcgctggacgatcttctacgtggaacgggaaagatggacgaggaggtcatggaggctccatgggggctttggttcttggac
gagatcgggacaatggaagtaagaagcggtacacggtgttccaagtgtacgtgcatttccagtcaggggctattcgagtgtcggagaagagatatagcca
cttccgagagctgcacaagacgctgagaaggaaatacgccacagtggggaaactctacttccctcctaagaaattcttcatgtcactgtctttgcgtgtc
attgaacagcgtcgagaggccatcgagacgtacatgaatgcagttctgacgctacgaccacgtcctgttgaggtcgtgcagttcttgaacactggaagta
gctccattgagagcgaagaggaggacggtaacagcacggatggagcagcacgcggagtagacacggtgactgcacccaaacaggtgcagtcgtcctcgtc
ggcgcttgcaacttcttcgcgactcagtggaagcaacagctttgcctcggaggacgttggtgggcacatggtgactatgcaggactttgagatcctgaaa
atgcttggaaagggatcgtttggaaaggtctacatggttagagaacgaggcacggatggcaagatctacgcgatgaaagtactacgaaagtcggagttgg
ttaagcgcaatcaggtggggcacaccatgatggagcgcaagatcatgagctctattgatcacccgttcattgtcggacttaagtactcgttccagacggc
cagcaagctcgtgatggtctccgattactgctgtggaggcgagatcttcttccatttgaagaagttccgctccttctcggaggccatggtgcgcttttac
gccgcagagctggtggcggccattggccacttacacgaacgggatatcatttacagggacctcaagccggagaatattcttctagacgagacaggtcacg
tgcgactgaccgacttcggtctctctaaaacggactgcacggacttttcaggcgccaagactttttgcggtacgccggagtacctggcacctgaaatgct
catcagccgcaagaaaaagacggagtacggcaaggctattgactggtggagtcttggcactctcatgtacgagatgctcactggctggccgcctttcttc
gatcgtaacattgagcagatgtgcaccaagattatgaagtcgccgctgaagttccctgcgcatttcggcctgagttctgaagtcaagagtctcatttcag
ctttgctggaacgggacccgacgtaccggattggttcgcgtcctggtgccggcgtcgaggatatcaagaatcacgtgttcttcgccactattgactggaa
gttgctggagaagcgaggcgttaaaccgcctttcaagccgcgtgtgcgcagcccgacggacatccagaacttcgaccgtgagtttacgaaggagttgcct
gaccatggtttcttgcagcaggataagcgtctcgccgtgtcgccgaagaacgagttccagggcttctcatacacaaggagtgaggaaccggcgttgctat
cgcgtgagtcaagcagcaaacgggagaaacgcagatcaggacggagatcggagccacgagttagcgaagggtacgtacgaggaagacattgaagcaacga
tggacgtgaacctggtcatcgtagggatccctctgattcttcttctttgggttgcgccttgggtattgctagaatcgagcgcgagtcccagtcagaggat
caatatcctgaattcggcctcgttgcccgcgacagcacggatttcgacactggttgcatctaaagcgcaagaaaaaccgggccagctagctgcccgtagc
cgcacgcccagtacaagatggagtaagcaggtgggagctgacattgaaaggtgcgattatattgtttctaatttagccttggtacaggtatgaagctgct
ccaagccaagttttgctgggagacgcgaatagcgatgtaagaaaatgaatgaatctaaagattacatgagattagcacgcacgccctcgaaactctttca
gtgattgcattgcgagccgttagctgcgtcgtgccattggtatttgcgatcatatccataaaacaccggcagcatcttgcgcatcgagtgcaacgttttg
tggtccttgaaattgtacacacgctgccacttaccgtcgacattggcatagcggtgcgaggtctcgcaggattgcgctgctttcaaaagcaccatcgata
gttagtaaaactcacactctgaaaggccacggaagcttaccattgcacgcagcgcacaagtcatagtcgctgcagacggcacagttaaaccgtgctccag
aaaagtcggtttctccacacgagtcacaaatgaagccaaggtgacggccttccattatgtagcgcagtgtagcaagtgcgtcttcacgacacttacgaaa
tgcactgcgcactcgaaacttggggatatccagcttttctgccaaattctcaacgtgttctagtgtgggccgtgtcagcgctcgagaactgaagagctca
catgcttcagcatagcgctccagaagcagatcgtgcagaaggtttaaaccactcactggcgagagttcgtcggaattttggggccgaacgcagaatatca
caatatcagcagactgcaatcctgcactttcaaccgatgcgtggtacgggatcaactcggagattatagtgggggcaatctcctctcgatacatttccag
ttgcgagcagctccaacctgtacggcgtgcgacaacttcgtacactaagctaggtaccagctttcctctttcacatttgttctccgtatccacaaattcc
ggtgatggcacttcaaggacacgaattttacccacatactctagccgattgactggcgctggttgcagcactttaacgaaaacgtatccttcaggcatca
tcaataaatcatttccagttgccaggtcgtacgacggtagatccagaggaggatcttccgtcactgagctgctttcgacgtaaatctgacagaacgagta
agcgtcaatgtccaccccgtcagacagtagatgcccatagcggccgatcttgaagagctttctcacaatggagtagtttgcgtggtcgaagcgcttgacc
cgacaccactggctggttaaagcaccacactcgcgtcttgttcaccgctgcatctgcttcactgtattctccgagcacttcgggaaactggttgtgcagc
gcgacatataagtcgagcagagagcagcagaaagggagttccagctccgcgacgtttgaaaaatctacgagacccagttgatggtgttctcggagatcgt
gctcaaacaccacacgaaatgttatggacattagccgcacatgagctgaaatggtgagtgtgtcaggctgcgtttgaccttcagctgtagtgtcaggaac
ccatgctgagggtcacgcagcacagctagcgagccgagcgaatgaactccccaattattgagatgcttgtgaaacttattgtccgtcagacaggaatgcc
actcaagtcgacgtttcggatccaaagcattttcaacctgcagagagaaaactgcacacgtaagccagtccggaggacgcattgataaatccgtgagtac
aaggtacacactaagcacgcggcctttgtactgggcctcattggggttgccgtttggaaatatccagagacaaaagcgatgtgcaccaattgtgaatgtg
cttgataccactttttcgacgtctctcataacttcgacgtcggaaaacttcggcacttttaccgaaatctcagctctttgttccttgtcatgcttttcca
cgaaacagcgtctccaacagcctccgtatagtctcaccaactgcacaaacagcaacaagaacacttttcagtctcccacaactcgtatccttcgcaaaaa
acatcatgattcccatacatcatagtctggagctcctggtaactgtggtagcacttgtgtcctcagactcggccatttccccatgcaaatcctcttccaa
acctcccggtcaaatgtcaacactctaaaggcgcgacacgtcgaagcacacgccagtaacgagtggccgtccagatgagcaagtgcgagtgccagcagct
cgtccggcagtgtctgaatgttgctagttaatgccttgagctccgtagaaagtgcgtcttccatttccacgtcgtccagactctcgcagtccgtttcacc
tgcggatccttcgctgacacggcactgagtcaagcgtgggtgctgcttgaggcgtctgctgcctttgctgctggtggggctgatccactggcgcttctta
gggctgagcgagaggcccgacgcgaccatcggcgactccgagacgtggatcttggcgaagaagcgtttgaaaatatggaaagagttgaagttgagggaaa
aaaagacacaaagacatgaaaaggtaacttatttattccgatcggtaattaaactcccatacaacaaaatacacaagatttcccattcgcgcaactcact
aaaccaaggcgaatttagagacgacacttagcatgaaggtggcaaacacgtttactgtatgaacatcgttgcgttgacttcgcgcaagcacaaggaaacg
gcgcaaaggtgatatttgggtgctcggtaacgtgatttgggtagccttttccaatatttgggtaaccttttccgagattttcaaaacggtgttttgaaca
cacgatggcgttgagtaggaacttccgcacgacctactacaagacgctgggcgtgcccgttgtgcagcatattgtggatgtggacgcttcatttgcggca
ctactcagtgagcgagtggtgaacgtgccgcagctgctgaaacttgcgctggagttgggcatcgcaccgcagtatcgcgcgaagatctggttgttgctgg
tgggggttctgccaccgtatccaggggtctggagttttgcccttaaggagagacgcgctatgtttgaggacgtcgttggggcagcacaagtcctccaggt
tagcgatatttcggacgatgacgatgataatggggtgtactacgactttatggggctgttaaaagagacagatggagaagagaagacatcttcaccacag
gaacttgcgagactggtgcatttacatcgcacttattggcaagaaattgcagcttgtgcttccccggttctgctgggaatggaggactgtaaattcctgt
taggtctggctcgagttgtgtgtgaagtggtgactcgagaggaggaacgcttttggtgcttgacaaggatgctggagttatttcacgacggtctggagct
cgtggatcctgtggtgactctggatatgctgtataattcatctcttccagagtttgaaggcattttcctgcgaaccgtagatgtgagacgtcgacgactg
acagcggacggtatgagtctacatttagttaagagtgtgcacgaggaagactacagcagacgaaggtttagttaaaataattcacgagtaacaatcaaaa
ctatgccgaacggcaaattacgcgaatccttcgacatcatcatcttcgttgacgctgtcactatccaaaacctcccgcttcatagctttccgggaacgcc
gtcgtcgctttggggtggccttaggccttttcacctcctccaggtcaatatccagctgcttttggtccttgcgagccacgagccacgcactcatgaacag
attccagttgcgctcaataggatcgtcagatcggcataagtcgtccacggaaggtaacagcagcttctttggggaccgttccctgcctcgactggatcat
ctgaggacgatggtttatacgtagcgcacttctcgttgtccaattggtaattccgcttgagcgcgaactttaggcggagcatcagtgcaatcgcaaatgc
aatagccccgttgttctgtaaatccgccaacttcgccccagccacagaccgcagcttacaatcgttaatcttcacttctgatagattcgattcatcgtcc
tctaagatttttgttgatacacccgcgttagcaaaagtttccttgagagcatccatcacagtgctacacatatgtggataaaaagtgtgagcattcaaaa
agacaactatgccaaaaaatatgttctacctggttggtatacgtacccaagtcgaaggctcacatagcggttgatcaaataaataacgtagagcggttcg
tcctccacttcgaaaggtaacgctacgatgatttgcgccagatagcacaaatattttaagcgagccgtgaaggtttggttattggtcgtcgaaatattgc
tctttaatggcttgagaacaaccccctggtccgtgagctgattcaccaatgccgacagaaagcgtgatgtgtacgcttgtgtcgacttgacgcaatttgt
atacagtcgaccaaataggcaaaaatctttttggttctcgtcaatcgccagtgttgtaacattgccatatactttctcctggaacgagtacgagtcacga
atgccctgcatcattggtgcgtgaaattgactccgaaacgtctcatatagaccaagcaattgggagaatgccgcgtcccgaacgtccagaactcgatcag
tctccagtgccaccaagtaaggaatgcattgcaacggattcaccaaaccttgcgtaagcaaagctccgatacatgcgatggctgcctttcgaatttgcgg
caccttctgtaccgtcagcaacaatatgtttcccaactccgcctgcatgacatttccaatcaatgaagcatcagcttcctggtcacctcgtacttgctgc
tccttgctctttgcctggttcatcgtctgagtggctatcccattttcaaaccgtttttcttcaaataccagcagatctttcatgcttacgagacattgta
gcttcgcttttcgcgtattcgcggttaaaaggaaatttaacaaaccatcctgctgcgcttggagaaacagacgcggccggactgggaaaagaaatcccat
cccttgtactgctttagcagcgcatgtatcgttgtttgtcattcgcacgaactgcccgtacaatttgtagagcgaatctgcaatcgttccaatcttcgtc
acggtcgctttcgtagccagctcctgacaattatcgatgtctgtaactccaacaattttccctgctacaaacaaagcgcgctggagaacattgttgtctt
gatccgtcaaatcggcaagcaattctctctgtttgaacttcgatatgatgagaaagaagtattccagcaactcgaacaataactcaggtgctctgttctg
tgctgctgatagcgtagcgaggcactggatactcggaccaacaacgcttggggaagatcgttgcaccaaaagttttaaatcgttttccagcccaatagcg
acactccgcggaacgcgtttaacacgcagaatcttatttatcatagagactgacaagtgttggactgttgggtctggttccgtcaggtaaatacggatcg
tcgcgagatgatgagctaagagctgaggtttcgcttcgcaaaaggcatccagcgcaaccatgcaagttacaaattgctggtgtctatcttttatcgaaac
acctttcaacagcgcatcctcttttaagtccatgaggcattccaccattcgatcaacaatttttccagatcggtcttcagcaatttcaacttgggatgac
caacgtttcacaccttgtaatgtctttttgctcgtgttgttactgcgttctgtcaatagcctcttgagaagttccttaaaccattcaatttttggcacgt
catggataacctcaacgatggttgcaacaatctctgagctgttgtcgagcgttaagtcctgcttcctcacaacactggctggtgtcaccgcgggagttcg
gtataaagaccacgcttcttcgcacgagttggcgacacttcccccatcttctgaaacaaacttcgtacatacaactggagaatcagtttccttcttgacg
gtgattgcggcagtcgtccagccagggggtagagtgttaccatcaccaaattcgcccaacgggttcgtgagtcgagaggacgaaagctcggcaccaaacc
atacctcctgaaaagtatcaatgataaaatttttaataccctgatcctcagcagcgtgcccaactcgttcaacgagacagcgcatacacgcgctcttacg
tcgaagttcttcttccgtgatactgtcatgggacggattttgcaatgaaatcaacgctatcttgaaaattctgcacacgctctttcgaacttttattccc
ttgtctcgtaacctttcagcaagagtggcgaaatacttgtcaaactgttcatggcaaacaccggttaacataagaaaaaaaagttgagtacagcagacga
agaaaaatactcgtaccaaaaccggctgaagaagaacatacgttccaattaaatccacagcagcttctcggactgaaggtttttcgtccaagcaacacct
ttcaacggctccttgcacctccttttcagccatcaaaatcggatcgacgtcgacaactcctcgtaaacatttcataactcgcgctctaaggctcggcatt
cccttggaaagcagagccataatatgagctagcaattttgcgaatgatccacaaaagccacgttttacggcaaggtgtaaactcgaattcagagccaatt
cagttgtaggagcggctcctttaaacgtcgtctttacacctccagatgacgtatcccacagcaaaccccacaacttaatttctcgctccacacataccga
cgcgattctactccaattgctctccgactcggacatgaatgtcagtaaatgtagcctcttcgaatcgccatgatcaaagttatgtcgctcgagatgcatg
acaacaatatgcttcagcgcaatccggcgaagtaactcgatatcagtaattggtaattcagctttagatctcactgtctcaccagtaagaatcccacgta
aataacttgtatgttcttcaatgacagctatagaatcactgtcgtcctgctgatcaaccttcctctggtactgtttaatcgaggcacatattttcccgac
caagttgagcgcagcaaggctttgatgtgaatccggattcttcatatctgtggatatgttcgcgtgtaggatactcgccagtgaagaacttaacaccttt
aacagacattctgcaccaacccactcggggcgtacaaacattaccagaaggtcttcaacaaaattatccaacaccactcgattatcacgatcttcggact
tcttccagcaggcgttcagcagcatctgaataaattgctgtgctattccccgcaaatcttccaacatttttgttaccccgttgcttctcagaggttcttc
agtggctgcttccactgggtcaattggttcttgtagtgtgtcatcgcctatggcagctttctgtgttccaagctttccaccggtagcacacgactggatt
attgatacggctaatgttgatatacgttgcactgtctcgtccgagttcggtaaccttaccattcgaagcgtacgtttggcagtagggagctttaccatga
tagccacaatatcacttagcaatgactcacgatgaggtttatactgcatgaatatacctcgtaaaatgctcagggcgctttcctgcaacgaggtagcgta
tgaactgtggtccaacgaaaagagatccaccatcaatgaagatagacggagaatccatcgatccgcaagccttacactcaatactagcgtagcaagttgg
tccataaactcacaagccgcatgagagacgcgctctaccactctacgagtgcttttgtccgctcggatatttattcgagaagagcttgatgtgttatgcc
cagatagttgccggtggtcagaatttttcgtcatcagagtcaccgcgaatgaagtgtcaatgcagggaagcaatacacgcttaataacgtggtgtagaat
ttcaaagcaactgtcaagtgtctcctccgaaagggctcgtcgatcaacctggggcgttgtcatcactatcagctcacacatcgcaacatcaagtgatagt
aaaagccgaaaaaccagccgttcatcaatctgtgctttccttcggtcttttttcgataaatttgatcccagtacatcaatagccaagcccaatcgaacct
gtgtatcgaatgcgctcatcaacgatatcaccaactctggctcaagcttagtaatccagtcgcacttctccatagctttcagtgtctgtagcagcatgtt
cacttcttcttcccgaaacacatccacgccattccgttcaaaattctccagttgctgacgatcagtagttaaatgaaccaattcctccaagaactcagca
tgcttctccacagagtctgcagtaatgatcgcctgagtggcaaacgtcgggatatcttcatcatctcccacctctgggttcacgtaaagttcatcattca
actcatccaacacagcgtgaaggtcgccacgttcattttccattgtgtcttcacatttcacgcttgacgtagatagccgtcgcttccacggtcgctcagt
actttcttcgtgctccaagcttcttttcaatctacccgtcgtagtcgttggcttcactccagctaactcaacacaatcattaagccatccctccttctct
tcataacaaattgtacgaaattctgtactaaccattgaagcatcctgcctgcaccacaccctgtgcccatttgggcagcgagtttaacacatctgcgttg
atttccgtcgtctcgcctgccgagctacattatcaagttgtaaagttggtaatacgttatatagttgctttgtagattgtcccacctgagtctgttagtt
gtagagcgaagaattgtcgccaaccgctgcgggttaaacaactcggcacctgcggctgggtcataggtcactgggtgtatatcttcttgcgcatccgctg
ctgcagcatccaccggatccacatacaacgggaagaggaacatcccgccctgcatcgtcctcaaccacaatgcggaatgagagtgattgtcggcaatgtt
tagcgtaatgttgcactaatgttgcaccagcaaactgattgaccacttcaaccagaatttgactgactcgttgcacttctattcaattcaactttttgaa
tgctgccactaaatgggcctacgcaacctttggacgcgtcctggcagggattgagcgcttcttcctcgttccagacattagagctcctgacctaaagatt
gagtgcattgtgcggagctataaatacagagtttagtgattttctgcaaaatataagtgcgtgatatgttcctcaccatgttccagacccagacgcagtg
cagcactaacttgatcttaggaagtgacaaaacagcgctgcctcgggcaagacgtacgatgggaacgatcacatcgccgtatagtacgagggaagctaca
aacagcatcaagcggataaactgttccttgtcattcacactgtaggtagaaacttcaggagcatgcttttaccagcgctgtgctacggaaatacacgagt
agtgtcccccctgcagctgctaatcgcgcagcttccggcttatggtagtctagaatgcagacaatggccaacagcacaacaacaacctacacacaagtgt
tattattgggacgccaaccccccagagcataatacactaccaattggatgtagatagcgagatcgatagctcgtgaacggcctgcagtcgacgccgggcc
ccacaaggtgcgatccaacttgttgtggtgcagcactaccatc