Description :
From Genome Similarity Track
Location :
Scaffold_2186:1575- 2927
Sequence
1352 bases(100 bases per row)
GATGCCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCG
TCTAGTACCAACCGAGTGTTCGGTCGACTGTTGAACTTGTTGACAGCCTTGAGTCTCGACACATGCACTACTGAGTAGAAGCGATACCCACTTCGGTCAG
GCAGTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCG
TTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTGTCGAAGCTTCTGGAGGGTCCGCC
GAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGAT
AATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGA
CGACATTGCCCTCAACGTCGACTGAGCATCCCAACCGTGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGGCTTGAGAAGTATTAATCGCAAATACT
AGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTATAGGGTCTTCCGCGTACACCCGTACGGAACCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCAT
TAGCCTGTGGTCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTAATGAAGCGTGGGTCGCGGTCGTG
CCTTATTAATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAGCACTTGGGCAGCACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACG
AATCCCGTAAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGAGATCACAAAATCCATCGAGACGATCTGGAAAGGTC
GTTCGGCTAGTACGTTGCCAGGTGAGTATCCACGAAACTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACAGGACTTCACGTGCTTCTCCACGTCTGC
GTACAAGCCGATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGCGTCGTGACAGTTTTGCAGGACC
TCTTGAATCATCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCC