Description :
From Genome Similarity Track
Location :
Scaffold_1084:1575- 2705
Transcript NameFunction/comments
Phyag_g9424hypothetical protein

Sequence
1130 bases(100 bases per row)
GTGGCGAGTGTTTCGGCTTCCTTGGTATCAACGGCGCCGGCaagaccaccaccatgaaAATGCTCACGGGAGACGTCCCTCCCAGCAACGGCACGGCCAC
TCTCGGAGGTTTTAACATCCTCACAGAGCAGATTAAGGTGCGTCGCCAGATCGGATACTGCCCACAGTTCGACGCCTTGTTCGACCTACTCAGCGTGCGC
GAGCACCTGGAGCTGTTCGGCGCCATCAAGGGAATCCCACAAGCATCGCTCGACCGTGTCGTCACGGAGAAAATTCATCAACTAAACCTCGGCGACTTCG
AGCACAAACTGGCTGGCAGTCTGAGTGGAggcaacaagcgcaagctgtcggtggccatcgccatgatCGGTAACCCGGCCATCATCTTCCTGGACGAACC
GTCGACCGGTATGGATCCCGTGTCTCGCCGCTTTATGTGGGACGTCATCGCGGACATTTCCACTCGTGGCAAGGAATCGACCATTGTGTTGACGACACAC
AGCATGGAAGAGTGTGAGGCTCTGTGCTCCCGTGTTGGTATCATGGTTGGCggtcgtcttcgctgctaCGGAAGCGTACAGCACCTGAAGTCTCGGTTCG
GCGATGGTCTCGTGTTCGATGTAAAGCTGGACACGCCGGGATCCGATGAACTGGAGTACTTGCTCCAGCATGTGTTCGCTGACGGTAACATGCAAGTGAC
GCCAATGGATCTAGAGAGTAAGTGCCGTGCATTCGGCGATACCGAACTCGCAGAACGAATCACCGCCTCGCACCCGACCGGATACAGTCTTGCTGCCACG
ATGGAGCGAGACGGATTTATCCGCGCAGAGGCCTTCTGTTCTTGGTGCATCGAGGAAACGCGCTTCGACAAGTTGAATGATTATCTTCTCAACGCATTTG
GCCTGGAGGGCGTACTGGTGATGGAACGTCAGAACGATTTCTGCCGCTTCAAGGTTCGCAGCCTCAACAACGAAGTGAAGCTGTCCAAGATGTTTGCTCT
GGTCGAAAATGTGAAGACCGACATGCACATCCGTGAGTACAGCGTTTCGCAAACaacgctggagcagatcttcaactcgttcgccagccagcaagaagaa
gagaagggTGTTGCTCGCGGTGTCTTCCAG