Description :
From Genome Similarity Track
Location :
Scaffold_2926:1575- 2584
Transcript NameFunction/comments
Phyta_totarag14940hypothetical protein

Sequence
1009 bases(100 bases per row)
NACTTCACGATCTCGAGGGTCCAAGGTGACAGGAGAGCTGCCCACTGACCTAGTCGATCCTGGAGGCCCGGCGACCTGAATAGCCATGCCAGAGTTGAGT
GCCGAGTAAGGATCTGGATCTGGCGCCCCACTAGCATATTGTAGTTGAGATCTAGGATCCGCAGTAACGCTAacacttccttctccaccacattGTAGTT
CAACTCGTTTGACTTGAGCGTCCGACTGGCGAAGGTGACAGGACAGTAAATCTGGTCGTGCTCCTGCATCAGAGCAGCCGACATCGCCCAGTCACTGAGA
TACACGATCACCACTGGTAGTCGATCTGGATCGAAGTGGCGCAGAGTCGGTGTCGTCGCAACATTGTGAAAGACTTGTGAACTCGGAATCACCGTTCATC
CGCGACGTCCAGGTCTGTTTGGCCTGGATCCAACGCCCCTAGTCCTGACGAGGCCGTATCGGATGACCCCTGATCTAGTTTCCTCAAAATCTGACGCAGA
TCAGGACGTGTTCTCACCTCAGCGAAGCCCATCTCACGCAACTCGTATAGGATCGCCGCGTAGATCGTGTAGTCTTCTATGAAGTGGCCGTAATAATTTA
AGCTGCCCAGAAAAGACTGCATCGATCTGAGTGATCCTGGGAAAGGCAGGTCCGTTAATGCTGACAGATCCTTGGGGTTGGCCTCCAGACCATCATTTGA
CACCCGATGTCCTAGATAGTCCACCTTGCGTAACCCTCAGAAGCTCTTCGCCACGCTGATCGACAGGTTCCACTTATCACACGTTTCCAGTAGATCTTCC
ACCCGATTGCATAGCTGATCCCAGGATCCGGCTGTCACGaggatgtcgtcgatgtagGATCTGCGTCCCAACACCGATGGGCGTCCTGGATCCTCCGGTT
CCCCAGCCTCAAACAGATCTACGATGCCTTTAGGATTCCCTGATCGCAGGATCCGCATAAATCCATACAGTGCGTTATCCAGGAGCCGGTGGTAGATCTG
GGGTGCGTT