Description :
From Genome Similarity Track
Location :
contig_51:157490- 158859
Transcript NameFunction/comments
g8620.t1hypothetical protein

Sequence
1369 bases(100 bases per row)
ACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGATCAGTAAAGATGACAAATGG
CTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTAAGC
TGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGATGCGTCACAGACGACACTAA
ACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGCTCGGTGTCCCAGGCCCACTC
CACATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCGAGGCCAAGCCACTTGCGTAAG
TCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCTAAGAAGGGGA
TCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGTGGTTGTCCAC
ATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGAAGAGCTGCGTCACTAGACGA
TTGAACGTCGCGGGCGCGTTCGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGTCGCTCG
CACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGAGAACATCCTTCCTAGGAATAGG
CGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTCGGCGTCGAGTGC
GGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGGCAAGGGCCACTGCCTTGTTA
CGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACATCTTGGTATTC
CTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGC