Description :
From Genome Similarity Track
Location :
Scaffold_31:157485- 162485
Transcript NameFunction/comments
Hyaar_Emoy2804732hypothetical protein

Sequence
5000 bases(100 bases per row)
TGCTGCGAAGGAGATAGAAGGAGACCACAGAGGACGGAACCTTGAGCAGCATCTGTACAATGTATTGGAGGATTTCAACCTTTCATCCAAGGTCTTTTGT
ATCACCAGTGACAATGCTTCAACAAACGGCACAATTGCAACGTGCCTGGAGCAACGGTGTATCATTCCTGGATTCACTAGAAGCGACAACATGCTTGGGT
ATATGGCTCATGTGATAAATCTGATAGCTAATGCTGGTATAAGGCTACTTGGAACATTTGATCACCACTTGACTCAAAACATTCAAGAAAATATCATTTT
AATGTCCACAGATGCGATACTTGCGGACCAAGATAGAGAAACTGAAAACGATTACATTTTAATGAATGTTCGGGCTCATTTTTGTATATAATCTAACTTG
TCAAATTGTTTCAAGCAGTGGGTACAATCTTATGTAGAGTTCGGGACTTCACAAAACACATCAACGGTTCGCCGCAGCAACTTCAAAAATTTTAAAATGC
TTGCGGATGTGGTCGCATCAGATATCAGAGCCAAGAAGATGGCACAAGATGTGGCCACGAGGTGGAATTCTACTTTGGCAATGTTGAAGCGTGTATTTTC
GCTTCGCAAAGTCATTGCAGCTTATTTAGACAGCGACGTAGAGCTTCAGAGATATGTGATTATGGAACATGAATGGGCTCTTGTGCAAGAAGTTATTAAG
CTGCTCGAACCATTGGAAGATGTATTTGAAGCATTTAGTGTACATTTATGAATTGGAACAGGTCAAATCTGTTATTGTTTAATTTTCGTAGGCTACCATG
CTTTTGTCATCTTCAAAATATCCATCTATTATGGCAGCTGCACCTGTATATGCCATGCTGTTGGAGAGTATTTAAGGAGCTCTTCGCTCATATGAAAGTG
CATTTCTTGAATCATCGATCAAAGCCATGGTGAAGAAATTTCAAGCGTACAAGGAGAGAGCTGATGGGCATTACTTATACAAGCTTGCAACAGTGTTGGA
TCCTTGGATCAAGTTAAAGTTCTTCAGCGACATAAACGACGACACTTGGGATATACGCGATCAGCTTTTAAAAAGAGCTCAACTTTACAACGCACATGAG
CACGCCAAACGGCTACATCCAATTTGGAAAAGAGCGGCTTCAACTCCTACGCTAGTCGACTGTACAAGAAGCGCAAGACTCTTGATCTTGATGACGAGAT
TGACCGTTATTTAAACGGTGAAGTGGAAGACTCCGACACGGATCTACTGCTTTGGTGGAAATCAAAAGCTACAACATTTCCAAGCTTGACGGAGATGGCA
CGGGCATACTTGTCGGTTCCGGCAACTAGTGTACCAAGTTAAAGACTCTTTTCTGAGGGCAGGAGAATTATTACTGACTTCCGTGGTTCTCTGAGTGCTA
GTAATTCACAAGCGCTCGTGTGTATGGAGAACTGGCTGAAAAACGACTTCATTGATTTGTATAATCTACTACGGACTGCTATGATGAGCCATCATTCGAA
AACGACGGCTAAATTGATCGACAAAGACGAAGTATCCCAACAACTGCTGCATATAACAATGACAAGAATCTTAGATCTCACTGACGTTAGCTAAATATGC
TGACAGCCGCCTTATTAACAGATCTTGTCAAATATATTTGGAACCCACCACAAATTATTCATGTAAAAGTATTTTATCTCCTCCTACGCCTGTGCAGCCC
AACAATTGCAACAACAACTCCACCACCAACAACAACAACAATCAGAAGTTTTAAAGACTAATGAATGCATTACGCCCATGGCTTATAACTCCATAATATA
TCTGCCTAATGATGAGACTTGTCAGCGGTCCAATTTCGACATGGCCAGTCGCATCATCGCCAAAAACAATCTTTGTCATCTACGTGGCTTCCTCTACCTT
GATCATCATGCGAGTGACGCGCACGTTCTCGTGTGTGTCCACTCAGATCTCTTTGACCAGCATGGATCCCCTGATGACCATCACGATATGACCAAACGCT
CAATCCTGCTGAAAAACAAAGATATCGTGAGCAGTTGAAATCCGTTTCACGTTGCCAAATAGCACAATAGCAAAAAGGAGGATGATATACCGCTGCTCGA
GATGTGGTGACAACGGCGCTCGTGGTCGGCCTCGTCTTCCTGCATACTCTTAAATCGCCTAAAAATAGCAGTTAAACACAATCGATCACCTATACAAGCT
TGTAACCAAAATGATTGGAAGATGTACATGCGTCTATAAAATGTGAACGTAAAATGATATGTATCCGATGATCCGTGGAATAGGCAAGATCTAAATCAAA
AGCAGTGCATAATGAGCAGAGTCATGGCAGAAGAAATGTGCCTATTACAGATACACATCTATTGAACGTCAACCACATATACAATGCTAATCGATTATAG
CGCATATTTGGACGTACACGTTGGCCCGTTTGACGGTTTCCTTGAGGGACCTTGCCACATGAACGCATGACTTGCTCACTTGATCCGAAACACGTTTCGC
ACTTGTACATTTGGGGGGGGCTCTGTTGCAATTCAAGATGGTGTGGTACACACGAGTGTTTTAGACCAAGGGCGACCCAATGGATCGTTCTGGACCAGCT
GGTCCAGGTCCTGGGTCGGGGTCTGACCCGGACCAATGACCCTAGGTTGGAGCCTTAGTGAAAGGTACGAAAATCTATATAAACGATCTTCACTCAAGCA
GGCTTTATGCACGCTTACTACACTGCATGTAGCGGGGTATCTCCGTTACATGATAATTTACTTAAGGTAAATATCAAGTACGAATATTGCGTTAGGACAA
ACACAATATTCTCACAATATTATCCTAATAGATAATATTGCCCCGCAGATGTAATACACTGTTCATTGGTTGATGTAGGATCGAGATATCTACCAATAAA
GTCTAGCCACGACAGAAGCACGCAACGTGTGGCGCGCAGATAGTTATAATATATGTTTGTATTTAGACATAGTTAAATGAAGTCAAATAGGGATTTATTA
CAAGGATTAACTATACTATATACAGTTCTACTTTTTACCTTTACTGAGTACTCTTACTCCGTATAGCAATCTTCCTCTGCACGTACGTGTACGTGATGTA
GTCGGAAGCACACACCCTTGCACTGTCAGCAGTGCAAGGTTTATTCAGTCACTTGAATAAGGTGCGCCCCTTTACGCTCCAGGCCAGAGGTAAAGTACAC
GCGCCGCTTTTCCAATAATCTCAGCGACTATTACGAATTAAGTACTGCTATTTGAATATGAAAGATCTGTAACGCCATCTCTGACAACGCAAAGTCAGTA
CAAGGCACGCCTCGAGTTGCAAGCACGTGGTGCACCGGTTCCACCGATTAAGGGCGTACCCATTCTCTTGTCCGCAGGTGAAACAAAGGACGAAGAAGAC
AACGACTTTATTCGCTGGGTGCATTGCACTCTTCGCCTCAGCAGTATGTACGCTCTGAGAGCTAGTGTCAGTGTGGCCGATGTGCGTCTCGAACGCAAGC
TTCGATATGACTATGCCAAGCTTAAGGCCAGAGGCCAATTGCGTAATCGCACGCGCTATGCTTCGGCTACTACGGTAGCCGCGAGTGCTGGTCAGACTGT
GACCAAAACCCCACCAATCGACACCACTAGTGGTGGGAAACGGCCTCGGTCTCGAGATGACACTGGCCACGATGTTCAAAAACATCCACGGCGTATGGGC
AGTCTTGCCGAAAGGGAATCTCATATTCTCATGAGTTCTCCGACTCTGGGTACCCTCGCCACTTTACTAGATACTGGTATTGACCATGGCGACGACGTCG
TTTCAGAAGTCTCTCCATGTGGAACTGGCGGTTCCCTTTCTCTCGAGCAGCGTCGGTGGGGGTCGGTGTACCGAAGGAGGAGCATGAGAAGGTACTTCTC
GAGCTGAATGGTCTCCGTAAGACATTGGGTAAGACCCAGAGTGCGCTCGATGCGACGTAAGCTCGCGTTCAGGCGTTGGAGTCGGGTCACACCCGGATGG
AGGCCCAGCTTGACCTCCTGATTTGGATGCCGACGGCAAGGCCAACTTCCGCGGCGCAAGCGCCTCCAAGTTCACGTGGGACGGATCCCGATACGGCTTA
AGCAAGCCCACGTAAAACACCGGATGTGTGCGCAATTTGCGTGGAAGGTTGAGCGTATACGCAAGTCCCTTCTTGGAAGTGACAGTGAATGGTCCAATGA
AGCGCGGACGCAACTTTGTCTTGAAGACTGCGGACACTACATTTGTAGGTAGGTTTTTAGCATCGAGTAATACCGGTCTCCGACCTGATAACGTTCAATA
CAATCTCTGTTTTTAGCATGTGCTTGTTGTTTCTGTTTGTCTTTTCTTTCAGCCATTGCGTCACGCACATGTCTTAAGACATTCAATCGCGTTGCGAGAA
ACTCGCCTACCTGTTTTCGAACAGTAGCAGGGCTGATATCAGCAAGTCGATCGGCAACTCTCTTCCACCAATCCCTGAAACACATAGTGGTAGCGTTAAC
GGAACGCGAGGGTGGGTGAGACCGTTTGCATAGAACGGAGTATAGCCTGTCGAGGCATGAACAGCGTTGTTCAACGCAAATTCAACAACAGGGAGCATGG
AGCTCCAGCGCATAGGAGTATCAGCGCAAACACTGCGCAAAATGTCATTAATGACGCGATTAACACGCTCAGTTTGACCATGGGTCTGAGGATGATCCAC
TGTGGACATGTCCAAACGGGTGCCGAGCACCTTGAAGATGGACTTCCAAAACTTGCCAGTGAAGCGAGGATCTCTATCAGAGACGATTGCCACTGGCAAA
CCATGTTGTCGAAACACACGGTCGATAAACAGCTTCGCTTTACCTTCGGCATCAATAGAGTCCGGCACTGCTGCTAGGTGATCCATCTTGCTCAATCGGT
CAACAAAGACCACAATGCCTGTTTTGCCTTCCGAATCTTTCGTTAGGCCAAACACAAAGTCCATACTCATGGACTCCCAACACCCGGTGGGTACAGGCAG