Description :
From Genome Similarity Track
Location :
Scaffold_327:15744- 19163
Sequence
3419 bases(100 bases per row)
GCGGATAAAGATTCTAGCTGGTGTTTATACGAAGATTAATCCACCAGCGGTTCGGTGGTTCCAACGGCGATTCCTCTTCACGATATTTGGTTGCTTCACA
GGCGAGAGTTTGCCACTCATTGTACCTTCGCGATCCCACCGACACGTATACTGGCGATCTGGGTATCATATCAGTATTCATCCACCAGCCTAAAGAGGCT
CCAGGATTTACAATCACCTTTCGATCCACGATATTGGTAAGCTGCAAAATTTTCTTCGGCCTAATTCTGTAGTTACTGTTGGTACCCAAATTCTTCCCGT
CTAATCCATATCTTGGCCTTGGGCGCAACCATATTGATCCGTACTTCGTCGATCCACCCACTAGGATTTTCACATGATGATCATAGTTCATTGTTATCGG
TTGCATTATCGATCAATATGTAGGTCTCCTCCCAGGTAAGAGTATTTTAACTTATCCAGTAGGCGAAAAAGTCCATCCACTAGATCCAAGCGTACTCCAG
CAGAGACCATACAATTCACCCACAATATCGATTCCTGGCTAACTTGATCGCCTACCAAGGCATCGAACTAATATACCAGCGATCCGTTCGACGAGATCTT
GATCTTGGTACGTCCCACATTCGTGTATATATTCTCAATAGATCCCACAAATTGTTGCCTCTGACTCTCGTCGATGACGCAACCTACCTTACGAGTAAGA
GTGGTATCGACAATTTGAGACTTTAACTCCTGAGTCCAAAAGAAACGTAGTATTTTCGTTGTTGGTATTTCCATTGCCTTGGCCTGTTTTAACCATAATC
CAGGGGTGTGAGACCCTCAACATCCACGTGATACACCCGGGAATAAGTCAAGTGCCATCTCGGTGGGCGATATCACATACTTATCCGCCCGTTTAACACT
TGATATGGAAATTATATAATCAGGGCCAAATTATGTGTATTAGCAATCAGATTGATCTGACTGTCCGCATCTCGACCCTTCCAACTTCTTTCAACAAATG
CATAAATGCAGAGCCTAAAACGCTTGACTCGCGCCAGATTCCATCCTAGCGTCCTAGTTTAATATTCTCTCCACCTTGGGCGGAAACATTCCAGCATGCT
TGGGGCACATACCACTTGCAGATGAAATTGTAAAAAGCTACCATCGAGCATATGCCAAATGTGGTCCCATGCGTCCACATTTCTGGTAGGTCAATCTCTT
CCAGAACCCTCAATCACCGTGTTTGGTCAATCCACAATGGGTGCACGCTCTCCATTGTTCACCTCGTCGTGATCGTCCTCCCAACCGGCATCTCTCTGCC
AAGTACGATGATCTTTGTCCGATTTCACCTTATTGGATGTAGCTATCACACTAACTCTACGACATTTCACTTCCTCATCTAATCCACTTGATTCCAAATC
TGATTCGCTACTTTCACTCTTTTTATTGGATCGCTCGTACCGCTCGAGCAGTCTTTAACGACCATCGGATTCGGAGACACGACTATCCGCTGATGAAACT
TGCCTGATTCCATCGACGCTTTCATCTATAGAGTATGCATCCGCTGGTAAGCACGCGGAGTTCCCTCCATCTCATCTTCGTCCGGTACGCTCAGTAGAGT
CAGTTGATTGGCCAGATTGCAATCGTCTAATGTCGCAATGAATTTTTTTTCCGTATGGTTCCGACGTGTAGCTGATGTAGCCGAATTTCCTTCAAGTTGC
GCGATATTGGTCTGTATAGCTGCAGCGTTAAGGCGGTATAGATACTTCAAAGGAGTCTCGTCCGATCGCATCCCTGTGTGGTAATATGCTCTGGCCACTG
ACACACCCATGTCCGCTGACTGTACCAGTAAACATTCCAGCAACGGCTTCCATTTACGCCGGGTAGATAGTGTCAGCTGACTTTACCGGTTCTGCACCGG
TGGTGTTAGCAGATCGCCAAACACTATCCACTTTTCTTTAACGGTGTTTGATCGCTCAGAAATGCCGACTTGACTTTTCTGATACACCTTCGGGACCGAT
CTTCATATCTGTCTTTGCCGCTGAATTCCTTTTCAACAAGTACACGCTAGAGAATTGTATCACCATTCTACAACGTTTCGTGATGGCTACCAACGCACGA
CTACGATCCTCCTGCCTCGAATCGTCAGGATTGCCATATTCAGGATCGTAAATTTCAGATCGACCGAGATGCAATCCGACCGATTCTATCTCGATATCTC
TGATGTATGCTTCTCTAACTCTGAATCCTTGATGATGTTTTTTGTATAGATCGCTTGACGGGCTTGCTCTCGTTGTTCTTGTGGGAATCATTCCATAGTC
ATGTCGAAGCAGGAATTCTAATGTCCTTGGCTAGGAATCGTCTTTTTGTTAGCGCGTACAGCTGTCGATCGCGGTTCGGTCTTGATTCGATCAGCTATAT
CTCTTAGATGTACTATCCCACTTGGACCTAAGGACATGCGCTGAATGCCGATCGAGTCGTCCGGTTCAATCTCGAATTCAGCTGATGCATACTGTGACGA
TCTGGTGTGTTATCCTCTCAGAATGTCTGCTATCTCTGTGTCCACTTGGTCAGCGGAATAACATTCGCCTGTAGGGGAAATTTAATTTTGACAGAGCGAT
CGACTCACGTCGATCACCTTACTCTTATCATACTCCAGCAAACTTTTTAGGTTGAATGGTCCTGCAAAAGACCCCGTACTCACTTAGCAGCTCGATAATT
CTATTAGCCCCTATGTGTATTCAACGCTGCAGCTGGGGATGATACATTATCTTGGATCGTGCCGCTCAACTTGGGCTTCATGATGAGTAGCACTAAATCG
CTCGCTATCAACTTCTTGAGCATCTTTCAGTGAAGCTCCTTCGTCAACCCGTTTAGTTACCAATTGTCCATCTTCACATCATTCTCTACAAACTCTATCG
GTCGAACGATCGATTTTGTAGCGCGACCGTGTTCATGTGATCCTAGTGCTTCATTATTCTTCATTCGCCCTGTCTTCAGATCTTTTGTCTTTGAAGCTTT
TGGAGTGGTCTTGGATGAATTCATTTCGGTTGTATCCGAGTGGTTTTCACCCATCGCATCATGCTTTGCAGCACGATACGCGGTGGTCTCCGGAGAGACC
TCAGGAGAAGTCGAGGTTTTTCTTATCGAGGATCGATCGTCCTCTCTAATTTGCGTGTCATCAGAGCCCTTCATAAAACTCTAGTAATCCGGGGATCATA
TAAAATCACGCGTCTACGGTGATACTCGGCCTCTGGCGCTTCCATTCCAGGCTTCATATTTATCTTCTCATCTTCACTCCGGGACCCACGGTGAAATCCT
GTGTCACCATCAGATCCAGGCCAGCGCACCAGTGGGGAGCGGCGACCCCTCACTGTCTGATGCGATCCAAACCTTCTAGTGGCAATCAGATGACTGACTA
TGGGAGGGTGTATTATATT