Description :
From Genome Similarity Track
Location :
Scaffold_205:15740- 19894
Transcript NameFunction/comments
Hyaar_Emoy2812562mitogenactivated protein kinase putative

Sequence
4154 bases(100 bases per row)
TGTAACCTGACGTAATAACATTCACCGATGACTCGGAAGACTTAGATGATGCTACCGGGACATCGGTAACCACCACACCTGCATCGCGATTCACAAACGT
TGTTATGTCCTCGCCACGAGATGTGTCCACTACAAACACGTCTGACTGGCGTGGTGCCACGTTTGGCGCAGCATAAGCCTCGTTACTCAACGCCAGTACC
TTCTTGTCCGTTTTCTCGTTCTGTGTCGTTACAAGAGATTTCCGTAGACGTTTAAACACATTGTTCCAGCCAAACAAGTTGCGCTGTTGACCTTCTCCAT
TTGCCTGTGAACCATTCGAATCTTGTGCTGGAGGAGCAACCGGAGGCTTAATAACGGAGCCTAGGCGCATAGGCGATTTGAACACAGGCGACTGAAGCAC
GTTTTTGAAGTAGTGCGACTTTCGCGAGCCATCGCCTTCATTGTTTGTGCTCGTATCCGCCTTCTCTTTTGTAGCCTCCTCGGGTGAGGCTGCTCCTTCG
TTAGACGTCGTCCTCGTTTCTTTCGCATCGAGGGCAATTGTGGACGGAATCGTATTTGGGTCCTCTTGTACATCCTCATTCGTATCAGAAGACGTGGATG
GTCCACCAACTATGACGTCGGCGCGTTCGGAGCCAATCGATGTCGATGCCAACTCAGGTGCCAGGCCTTCCTTGTCATTGACTACTGAATTCCACACAGA
TGAGGTATGCTCTGTTGCTGGCTCCGAGTCCTCACAAGAAACCGATTCCTCTTTCGTTGAGGCCATCGCCGAAACACCATTCTCCTCGACAACAGAGTCC
ACCACACAGCCATGCTCGCCATTCGTCGCCTGTTCACTCGCAGAGCTTCTCCTCTCATCAGAACCACGTCCAGAGTCTGAGGTTTCTGAGCCAGTGCTTA
ATCGGGTCTTTTCCGATAGCTTCGCCCACGCAGGATTACGCTTGCAATGGAATACGACCTGTGCATTATTTTGAGATGGCGCTTTGCTTGTAAAAACTTC
ATCAATCACATCGTGCAGAATAGCGGCGTAAATATCAAGCGACGGAATGTCGACTTTTGCACGCAGCAATAAGCTAATGATGTTTTCAGGCACATCGATG
TCTACACCAAAGAGATCCCTCGTCAGTGGGCAATTCTTTGCTCGAGAGGCATCGACATCTCGAAGAAGAAACGAAATCGCTGGTACAATGTGGATAATGA
GCATGTCGAACGATGACCGGTTCTCGAGAATGAAAAGATAAGCCTGAATGAGTCCACCCTTGTGCAATTCCTCATCCACAATTGCATCGTTCAGCAACAC
CAAATTGTTCAGATACTTTGCCAACGAGATTTCTACGGAAGGTGGAAGCCTCTTATTAAACTGCTCTACGAACAAACCACACGTTTTCCGGGCCATATCG
AGCACATGTGTCCAGAGTGCGTGGCCACGGGGCAGCGACGCCAAATTGTACATGGATGTGTCGGTAGCGTCATGTGGTGAGTTCGGGTATTGCTCCGATG
AAAAGCTCGAGAACCCAAACATCTGAGTGTTTTGAACTTCCGTTTCCGCTAATCGATTACCGTCATCCTCTCTTTCAACGCTATTGTTCAAAAACTTTTG
GCACAGACACAACAGCTCACCCGCCACGTGAATATTCAGCGCACTAGACACTTCAGTCAAATTCTTGTCCCGAATGACACCGAGCTCATCCAAGGCACTC
TGAAACATCTCCTCAATGATAACTAGCTGCTTGGACATCTCCTCCAAAAGCATGTACTGAAGGAAATTGTGATAGCCGTGCGTCATTGACTCAAAACCAC
GAATCGTGCCGAACTGGTCGCGCACAAAGTACTTGGAAAGGTACACACCGCCCTCGCGGCGGCTGAATGCGCCCAATCGATCTGCCTGGTTTGCTTGAAG
CATGTCGACTAGAAGGTTAGTTGTATTTTCGACAAGCAGCAGGTTTTCGGGTGATCCTGGATTTACGCGGGTAGCCTTAGCAATCAAGGGTGCGGCAATT
TCCATGGCATCATTCCGTCCGGTAATCGGATGTACACTCTCGTAGCTCTGCAAGATGAGAGTGAGCATGTACTTAATGGTGTTTGAGTAGAGGTGGGGGA
TGACAACTGGCAAGAAACGCTTCAGCACATTACTAACATAGCCTTCCTCAAGGCAGAATCCGTCATGAAGACGCACGAGCGCTTTGCTGAAGAATAGAAG
CTGCATCTCATCCAGCGGAACAGGGTTCTCGAAAATTGAGTAGAGCTGTTCCCATTTGCGAATATCCTCATGCTCCTGACAGCCGAAGACGGCTGTGGTT
GCAGTTGATCCTGAACTCGAATCCGAGGAAAATGACTCGTACAAGTCTTCCTCGCCCGTGTACAGCTTCATAATAATCTCCGAGCACAAAAAATGTTTCT
TATAGTATCCGTACTCTTCATGCGGCTCTCCACTCAGCACAGGCGGGGTGACAAACGCCGCAAGCACTTGTTTCACCGTCTCGGGCTGCATAAGCCAGAG
TCGAATGTCCGAGTCCGTGTCTTCTAAAATCTCCAGCACCGGGTCAATCTGCATCTCTAGTAGCGCTGTCAACGTCATTGGTTTTTGGTTCATCGAACTC
GTAAAAAGCTGTTCATCCGGATACGACGGCAACGACCGTCGACGAAATGTATCAGCGTCGTCTAAAAACTTGGACAAACTACCTGTTCGTCCTTCTCGAT
TCGTAATCACATCCATCTCATTCACGGAAAAGCTCATCGTCGGTGGGACCGTCGGCTTCTCCAGAATAGCCCCATCGTCTTCCAGCAAATCCATGCCATC
TTCCAGAGCTTCATGGAACTCGTCGTCCTCGTCTTCATAGTCCGGCGCTTCAAGCACCGCCATCGTATCCATCTCTCCCATATGATTATCCTCAGAAGTA
GCAGCACCAAAGATCTGGTCTTCAGTATCCACCTGCTTCTGTATCTTCTCCGTCTCGTCTTCCTCTTCCTGCTGCTCTTCAGCGTCCGCTTCCATCGTCT
CCTCTTTCTCCTCAGTATCTTCACTGGTTACAGTGGACGCCGTGGGCTCCTCAACCGCAACGGATTCGGTTAAAATCCCATTCGCGTCGTCGGCTCTCTT
GGTCGAAAGACTCGTGACGTCGCTGGGCGTTGCCGCCGCCTCTGTGTCGTCCCTTGGGGTCGTCATGAAGGAGCTTGTACGAAGAGAGAGGCGTTCTACA
GATGCTCCTGCTCGTTGTCGCGGCTTCGAGACTCGACGGACTGCGCGACTCTAGTCACCGATGCAGGGAGTCACGCTATGCCGTGCATAAAGGGAGAGGC
GAGGGGGAGGGAGCGTTCATTGGTAGAAAACGAGCCAGCGACAGAAATTACGAGGGAGCGAGTCGTTGAACGACCTGGACTTAATGACTTGTGAGGGAGA
TGGAGAGTACTGATTGGCTGCTGAATATTATGAACACCCCTGCAATAAAGACGAGACCATAAAGAGAAAGAGCCTCGATAGAAAGCGAGAATGCTTATAC
TTCTAGTCGGCACACTCTATCACAACGCTATCCAGCGTCTGTCTCATTATGGGATAAATAAAGCATTCACGGTAGAAATGGGTAAATATCTGTCATTCGT
TTTCCAGTCATTTTTCGATCTTTGGCCCGACGAGAGCCACGGTAGAAACGTATTGCTTCAAAATGAGCATCTCTAGTACATTCACTGCTGCCCGGTGTCG
TCCATTTCCAGCGGACGAATGACGAATGAGTTAGCAAGGGAATCACTTGGGGCAACGGTCAAAGTCGTTTCTTCCTGTCGTCCGAATTATAGGGTAGACA
TTACCATTGACGCCAACGCTTATGTAGTCCAAATGGAGTGGCAAGTGCAACATGCGGACCGACTCCATTTGCGTTTGCAGCCATATATCGCCTGTGCAGA
TGGTTACAGTATGTCTAAGTTCAGTTTGATGATAGAATCAATAATGCGATCTTTGTCGGTTATGTTGTAGCTAAAACTTTCCCTTCTATTCAACTCAAAG
GTGAACTGACCCCGTTTAGCTTCTATCCACTATGCAATCACCGCTACAATAAAGCAAATTATCAGAAATACTAAACTAGCTCTTGCGACAAGAGCACAGA
TAATGAACAGCAGACAAAGCGAAAGAGAATCGTGTTGTAAACGCGTCAATCAAA