Description :
From Genome Similarity Track
Location :
contig_78:157393- 158405
Transcript NameFunction/comments
g12006.t1hypothetical protein

Sequence
1012 bases(100 bases per row)
GATCTTCTTCAACCACTACTGGGAGGGAGCACTAGACGCACCTAACTGGCCAGCAGCTAAGCCATTCTACCTCATGCCCAACATCGAAATGTACGAGCTG
GAGAGCATGCACTACTGGCGGGCCGACGTTATTTTGTGCAAGACAGCGCTGTGTGCTCGATACTTGAGGAAGTGGCTTAGTCAAGAGGGGAATCCTCGAG
GCACGCGCGTTGTTTACACGCGTCACACGACAACGAACCTGGCACTGGCTACCAAGAGTGAATTGAGCGCGAGGAAAGCGAACGAACTGTCGAGCAAGAA
CTTTTCAGACATTTCGTTCTTGCACACAGCAGGCAAAAGCATTCAAAAAGGGACGCGGCAAATCTTGGATTGCTGGCTGGGCCAACCCGAGTTCCCGCGG
CTGGACTTCTACATGGACCAAGAGCTCTACGACGGCGAGTTCGGCGACTACGAAGAGCGGATCAGTGAAAGTAGCAACATTTACCTGCACACAGGCCAGT
TGTCGTCTGGAGAATTCGGACGCGTGGTCACTCAAGGCCGCTACTTCTTGTGCACCAGCATGATGGAGGGCTACGGACACTATATCAACCAAGCGCGTTC
TGCAAATGCGTTTATCATCACGACGGATGCTGCACCTATGAATGAATTGATCACGCCGTCGTCGGGTGCACTGGTCAAAGCTCGAACGATCGCGTACGGG
GAGCAGTTCATGGGTGGGGTATCTGACAAGGAACACGCACTACGCAATATCTCGGGACTCGTAGCAAAGTTTGAAAGAGAGGATGTGTGTGACACTGTCG
TCAATCTCTTGAAGAACTCGACGTCCGAAGAGCGGGAACTGCGCGCCAACCGTGCGCTTCAGCAATATTACTTCGACACGGTCTTCTTCGCGCACAAGAT
GAACGAGCTGCGGACTTTCGCTCGCGCCATGAGCCACCCAAGCCTTCGTGGCAAGATTCTGAACGGCGGATCATCGATCGCGTAGCTGGTAGTGTGTGAC
AAGCTCAGAGCG