Description :
From Genome Similarity Track
Location :
Scaffold_6:15738- 17644
Transcript NameFunction/comments
Aphas_H257_03951myosin-like protein

Sequence
1906 bases(100 bases per row)
GGCGTCGAGGACATGTGCACACTTAACCATCTGCACGAGCCCGCGGTGCTCAAGAACTTGCAGCTTCGCCACGCACAGTTTGTGCCGTACACGTACACGG
GCCAGATCTGCATTGCCGTGAACCCGTACAAGTGGCTCGACTTGTACAGCAAAGACCTGTACTTCGACTACTTGAACCTGCCGCGCAACGACTTGGCACC
ACATCCGTTTGCACTGTCGTCGAGTGCGTACATTGACATGAACAAGCTCGGGATCGAGCAGAGCATTTTGGTGAGTGGCGAGTCGGGGGCTGGCAAGACG
GAGACGGTGAAGATCATGATGAACCACTTGGCGTCCATCTCTGGCGGCGGGACCCACGGGTCGTTGGTGATTGACCAAGTGCTCAAGTCGAATCCGCTGC
TGGAAGCGTTCGGAAACGCCAAGACCAAGCGAAACGACAACAGCAGTCGGTTCGGCAAGTTCGCCCAGCTCCAGTTCAACGCCGAGGGGCTGCTCGTGGG
CGCCCGATGCGAAACGTACTTGCTCGAAAAGAGCCGCGTGGTGGGCCAGGCTGTTGGGGAGCGCAACTACCACATTTTCTACCAAGTGTTTTCGCTGGCC
CAGGAGCTCAAGGCCGAGCTGTTCCTGGACGGCGACGTCGCCGACTACAGCTTTGTGCACGTGGGGGCCGGGTCCAAGGTCGACAACACGGACGACAGTG
TGTTTCTGCAGGAAACCAAGCTCGCCATGGACACGATCGGCATTGACGCGCGGGAGCAGCGGGGCATCTTTGAGATTGTGAGCTCGATTTTGAACCTCGG
GGAAATCTCATTCAAAGCCGACACGACTGAAAAGTGCTCGGTCGTGACGCTGGACCGCGTGGCGTCCGTGGCCAAGCTGCTGCAGACCGAGGAGGAAACG
CTTGTGAGTGCGCTGACCCACCGGACGATGGCGGCGCGCGACGAGACGTTTACGATCCCGCTGAGTGCCGACCAGGCGGCGGACCTGCGGGACGCGTTCG
CCAAGGGGATTTACTCGCAGCTGTTTGACTGGCTCGTCGCGCGCATCAACAAGGCGATCTGCAGCACCACGAGAAATGTCAAGCATCACATTGGGCTACT
CGACATATTCGGGTTCGAGTCGTTCGACCACAACGGGTTTGAGCAGCTGTGCATCAACTACGCAAACGAGAAGCTGCAGCAAAAGTTCAACAGCGATATC
TTCAAGACTGTGCAGACCGAGTACGTGGCCGAGGGCATTCCGTTGGAGCTCGTGTCATTCGAAGACAACCAGCCGATCCTGGACCTGATTGAGGGGCGGG
CGGGGGTGATCGACCTGCTCAAAGAGACGGGTGTGCTGGCCAAGGGCACGGACCAGATGTTTGTGAGCAAGGTGATCGCGGCCGCGGCGGACCACAAGAA
CTTTGAAAAGGTCCGCACCAACCCCATGCAGTTCAAGATTCTGCATTACGCCGGCGACGTCACGTACGACGGCGACCGGTTCCTCGAGAAGAACAAGGAC
ACGCTGCCGGTGGACTTGCTCGATTTGCTCGCGTCGAGCGAGTCGTCGTTCATTCGCGACGTGTTCCCCGACTTGGCCGTGCCGCGCAAGGACACGAAGA
AACACAAGCACCCCTCCAAGGCTCGCAAACAAGGCGGGGGGTTCCTCGTCGGTGCAACGATCGCCAATTCGTTCAAGAAACAGCTGGGGGAACTCATGGA
CCAGATCGCCAAGACCACGACGCAGTACGTCCGGTGCATCAAACCCAACGCCAACAAGAGCGCCACCGAGTTTGACCGCCTGATGGTCGTGGACCAGTTG
CGGTGCGCCGGCGTCATCGCCGCCATCCGCATCAGTCGCGCGGCGTTCCCGAACCGGCTCTCCCTCGTCGAGTTTGCCAAACGGTTTGACGTGATCTGTC
CGTCCA