Description :
From Genome Similarity Track
Location :
Scaffold_5:157325- 161431
Transcript NameFunction/comments
Physo_511451Hypothetical protein
Physo_334476secreted RxLR effector peptide protein, putative

Sequence
4106 bases(100 bases per row)
TCTTCTTGAGCTGCAGCCGAGATCAGAGCGGCACCACCTCCTACACTTACCAGCGGTCGACGTCGGGTCGTCGCCCCGGCTAACGCCCGGACGTCCAAAA
GTCGTCGAGGGACACCCAGTCGACATCCAAAAGCATGTCACTATTGCGAAATAGGATCCTTAAGACACCGCGAGGTGGCGCACCCTGCATTAGCCTCATT
GAGGGACGTGAGTACATACACATAATGTAGACTGGTAGTAAAGCGCGTTCTCAGTGAAACTGAGAGGGGCAACTTCTCCGCTATAGATCGCGATAGGGTC
GGGTACAAACACTGCCGACGTTATAATGCTTGCGATGACCTACATGTGAGCCCGTGTTCCACTCAATCAATCTCGTAATTGGATCTAGAGATGTATGCAG
TTGCGCAACTCCCAGACGACAAAGGAACCATTGAAGGCGCGTCATGGTCTGGTGTATTCGGCCCAGCCGGAGACGACGCCTTTGACAACATGGCTGGCGC
TGACACTCAAGTCGCTGTCTGAGCGCAGTCAACACTTGCTAGGGCGTCTCATGCAAGCTACTCAGCTTAGATCAGCGTCCACCCCATATTTTGTAGTTCA
TCCGGGGCATGGACATCCCATCGTTCAGGCAGACTCGCTGCTAGCTGGTCTACAGTGTAGACCAAAGGTGTAGACTCTACAGCATTCGATAGCGGAGCTC
TTCCAAGTGAAAATCATTATCGTACTTGGCTGTTTGTTTGAGTCGCGGATACAAGTTGATTGAGGCAATGGGCACGTCTGAGGTCAGGAGATTTCATTGG
CTTCACCAAAACTCCTTTTGACCAATCAGCAGAAAGTCGAGCGGAGGATGTCGGCTCGACTCGAGCGGACCCACGGACGTCGACAGAAAAAGACGTCGGG
TCAAGGTCAAAACCCTCGACGTCGACAGCTCTAGCTGTTACCCATAGCGTTTCGTCGCGCTACGGTGTCTTACCTGATACTGTACACGACCCTCGAGCAA
TGAGTACAGCTCCAGATGCCAAACCTCCAGCTGTGCTGCATAACTTGCGCTTGATTCCGGCCCCAGTTGCTGTCGTGCTCGAGTGAGTACTGTTTGGATC
GTGTGAGCCTCCACCTCGCCTCCTATGCCTCTTGGCAGCACCACACATCCCTCACGTCCGCTCTTCATTCCCGCACTTGCTCCATCGCCAGCACCCCCAC
ATACAGTACATTCCAACGGAACCCAACAATGAAGGGCCGATTCATCGTCAACCCCTTCCAAGAGCTCAACTTGACCGCCGCCGATCGAACCTCCCTCGAA
GACCTGGCTAACCAATGCATCACCACCAACCTCCAGCTCTGCATGAAGTACATGTCGGGCTCAAAGCGTTCGGTCGACCCGCACCACTGGAAGCCGTTGA
AGGAGAAGGAGAAGCTTAAGGTCTACACCGAACGCCCCGAGGGAGCCGCGTCCGCGATTGCGTCCGGTAACGGTCCCACAGGCTCCGGACTACCTATGAT
CCTGTGCGTCGGCACCATGGAAGGCAAGCTGGAAGACCTTATGTTCGGAGTCATCAGCGAAGACCTTGAGACGATGCGCGTCAAGGCCTCGTACGTCGAG
GATTTCAGTGGCGCGGCTGTGCTGGATTCCGTCGTGATGCCAACGCTCGAGGACCCGTTCCAGTCGCTCGTGATCAAGTGGATGGAGCTCGATATCCCCT
TCCACTCGACTAGTCTGGTCAAGAACCGCGATTACGTCTACCTCGAGGGAACGGGCTACATCACCACTCCGCAGGGCGAGCGCATGGGCTATCACTTGCT
ACACTCCGTCAACTTCCCACAGACTCACGCGCTGCCGAACCGTGTTCGCGGTAACCTCTCCATCGTCGGCTTTTGGCGACAGATCGGCCCGAATAACATG
GAGATGTACGCGACTGGAGTTATGGACCCGGTTGACTCTGGCTTGGTGCGTAGGCTGGTGATCCCGAACATGGCGAATGTGTTCCTGTCCACGTTGAAGT
ACGCGTACTGCGGTCAGATGCGTAAGTTGTCGTTCATGCTGGACAAGGCTTACACCGACTCGAAGCTGCACGGCGCTCCGAACAAGAAGAGCGTCTGTGT
CACCTGTTCGGCACCGATCTCGGGGCGGAAGCTTGGGGACTTCGGCAAGAGCAACAGCACGTGCAAGTTGTGCTTCGGGTTTGTGTGTCACGCGTGTAAG
ATCAGCCGGAAGCTGAGCTTCGTTGACCCGGACATGCTGCTGTCGCAGCGGAAGGTGACGTTCTGCACGGCGTGCATCAGCTCCGTCACTAGTGTCAGCT
CTGTGGACTGCGCGAAGGCGTTGCTGCTCAAGAACCACAGGGCCACCCACTATAGTTTCGAGCAAACGCTTTCGTCCGAAGGCAGCGGCGAGTATTCCTA
CGCGAGCACGCAGTAGGCGTTAGATTACAGAGTTGTGCTCGCCGTGGACACGAGGTTTTAGGCACTGAATGAATGAATATGCTTTATCTTATCGGAGTAT
TTGAACCATTCATCAAACGATACCATCACGGAATCAATGTTTTACTCGATAACCATCATGCCATTGACGTATCAAGCGGTAATGGAGAGCTGAAATGCGT
CACGAAATCATTTTCGTCGCCATATAGAGCCAGATGGACTGCGTGTCTTCCTACGAGGGATCATTTGGGGGATCGGATAGGTGAATCGCAACCTCACTTG
GCAATCTTTGGGCCAACCGCCTCGTCAGCCATGCGGCAATTCTTCACCCCTCTCCTCCTTCTCGTCACTTTCGCTGCTACAGCTTCGGCCGACGTGAATG
GAAGTTCGACTTCGCCTAGCTTGAAAATTGACTCCGCAGGCGGCGAGACTGCTCGGGATGCTATCGAAGCTAAAAAATCCTGTAGCAGGATTCAAATTTC
GGAAGACTGAGGAGGAAAAACAAATTGCAATGTGGCTGAAGGAGAAGAAAACACCGCTCGAGGTCTTCAATTCCCTGGGGTTGGATACAGGAACGAAGAA
TCTTCTAACGAACCCGAAGCTCAAGACTTGGAGTTTCTTCGTGCTGGATTACAACTGGAAGAGTCCTGGCCAGGCAGCGAGCATGACAGCGGTAATGACA
AAGACCTACGGAGACGAAGCTGTGGCAAGGAAGGCCAGCGGAAGAAGAACTCGGGGGTGAGGACAGTCGCCAGGGCGCTTCAGGCGGAGCAATTTGAGGG
GTGGTTTCTCAAGGGACTGCCCCCCGACGTCGTGTTCAACGTGTTGAAGCTTGACAAAGTGGGAGCTGATAAACTCCTTTCCGCCCCAACTTTCAAGGTT
TGGTACAACTATTTCCATTCGCTGAACCGGTACAACACAAACAAGGAGACAGATATGATCAAGCACTTGCAGGGTGTTTACAACGACGTCCCATTGGCGA
AGGCGATCGTGGTGGCGAAGAAGGACAAGGCCACGCAGGCCATTGCAACCAAGCTACGGCAAACGCAGTTTCAGAACTGGCTGGTTGAAGGGAAAACCCC
CCACGCGATCTTCCAAATGCTGATGAAGGATAGGATGCATTGGACGCACGAGGATGTATACTGGGGGTACAAGGCGTTCTACACGAACATATCGCGCAAG
GTGAACGGCATTTACACTGTAATACACGCCGACAGATCTTTTGATATCGGTAACTCAGAATGCAGCCATGGTACCGTCGATACTCTCGTCGGACGAGGCA
GCGGGTTGCCCTCAAGTCATCGCGGTGTTGCAGTTTGATCACGATTAGGCTCGTCACTACGAATACATGTATACATGGCCTTCCATCGTACACTTGAGTT
CAACAATGATTTATGGCTGCAGCAGATCGAGATACGAAACATGCCCCGTTACCGCACAAACCAAGGACATGTTCGGAACTTGTGGGTACGAAGTACAGTA
CAACGAGGCAGCTCACTATATTGAATCTCCTTCTGCCACCTGCCTCGAATCGCGGGACCCACAGACTTGGATGCTTGTCCACGTTGACAACGGAATGATC
GCTCGTCAGGATTGGCGCTTCAACAGCAGCAACGTTCGTCCCACCCTCAACATGGTGTGCATGTGCCTTTGAGCAGCCTAGGGGGTCGAGGTTCGAGGCG
GGTTTT