Description :
From Genome Similarity Track
Location :
Scaffold_69:157320- 160063
Transcript NameFunction/comments
Hyaar_Emoy2807785hypothetical protein
Hyaar_Emoy2807786lipoyltransferase and lipoate-protein ligase
Hyaar_Emoy2807787hypothetical protein

Sequence
2743 bases(100 bases per row)
GTTCCTAAATCTAATACAATCTGAGTTGAGACTATTTACTGTAATCACGAACAGCACACAGTAGGCACCACATCCATCTTTACTCGGTAATAATGTTGCA
TAACCACTTCCCAATCGGCAACCAGCTGCAACAACGGACAGAGACGAGACCCTCCGGGGAGCCAGGAAACTGACCCCCTTTCCTTGGGCGGGAAGTCTCC
CATAGTGGGGCCAAGGTAAAAAGGGGGGAGGGTTTCTCCTCGCTGCGTGCGCTACGGGAGGCAGCGCAGCGTGCGACCCGAAAGAGAAGCGGTCCGCAGG
ATATCCTAGTGCAGGGCACGTCGACGATGGATCGAATCACCCTGCAAAACGAAGAAGTTCCTACCCTTCGCGGTCTGCCTACAACTCGCCGAGCATGAGC
CCGGTCCCACGAAGAGAACTCCCCCAAGACCGTGACGACCCCCGTTGAGATCCAGTACCGGTTGTTCATGTACAGTAGCACCGAGCCAGGTACTCTTCGT
CCAGTGGTGCGTCTGGGCACATTTGGGCACGTTGTGAGCCCGAGCCGACCTGAAGAGCAAGAAGTCGACTACGAGGTGATGGCCAGGGATTACGTCACGA
TGGCTCGCTGGGACTACCGCAGTGGTAACAGGACTCCTAGTCAAGCGTCCTCTGTCCCCTGAATCAAATTGCTCCGAGCGCGAGAGCAGCCCCGCCATCC
GGTAGAGTGCACTTAAGAATCTAACCCCGGACTTGGTCAACGGACGGTTTCCACGGGCCCTTTTAAGAGTGCTCCGCCGTGACGCCCGACGTCTTGAGTC
AGCAGAATGAGAAAGCTAGGAGTAGTAAGACTGTGTCATGGTAGATGACACGAGGTGGTTACCACACAAGCAGACATCTTATTAGGGATAAGTAGCTAGA
ATAGACAGTCTGAGCCTCTCTGTAATAATGTTGCATCACTTCGACATTTTCCATCGTACAACCTTTCGTCGTACAACAATCCCTCATCCCCACCACATGT
TTCGCATCTCGAGAGACGACGGTCTCAATTCCACGAACCCAACACCAACCTCCACCACAACAAGAAATAACAACAACGAGCAGCCCACCCACCCTTCAGT
TGATAATCAGCACCGGGGCGGCCACATCACAATGGCGGACCCGGCGTGGGGTGCAGCCTCCTCCTCCCCTTCCTTACTACCAAACGAACCCACGGCCCAA
CCGCTGTACCCGTTCCGCTCCAATGAGCCGCTTTCCCAGTTACTCCAGCGCCATCAACCGCTTCTGTGCCAGGATCAGCCGCAGCCGCAACAGCAGCTAA
CCACGTCTCTGTACCAGCCGCTGCCTACTGAGCCGATGCACGTGCTGCCGCCGTTTGGACCGGACGTTTGTGCTACTGCTGACCTCTCTCGGTATGGACA
TCCGTCGAGTGACATGTCCCACGTGACGTCGTCTATGTGCACCCGACGTGAAGAGATACCGCAGAGGTCAATGGACAGGGACGCGCGCTCTTTGATGGAT
AATAGTGAGTGGCTCGTACAGCAGGAAAACAGGATACAGGTTCAATTGGAGCAGCAGGTACAAGAGCAGCAGCTGCAGCTGTCGATGCAGGAACAGACTC
ATAGACAGGCAGATGGACCAGGGCAGTCGTGGTACTCTTTGGGAGCTGATGGGTTCAATTCTATTCAATCGTCCGGCAGTGATGCACGCTGTTTGGACGG
ATTGTCGTGGCGTGTTCAGGGTGGTGGGCGTGAGCACACTGCACTGCACCGTGACGTGTGGAACGCTGCACCGTTTTGCAATAGCAGAGATGGAAGCAGT
GGACAATCGATGATTGGGGCAGGGACTGCGCTTACTGTCGCGCACTTGTATATGTTGCAATATGGAGCAAGTGTACAAGGAGAAGAGGCTGTGGGCACAG
TAGACGGAATACGTGCGCAACAACAGATTGCGCAGTCAATGCAAGCGTACATGCATCATCAAAATTGTCGCCTGTGTGCTATGAGTATCGCGCTTTATCG
ATGGGCACGAAGCAGTCCAATGTTGTCTGCAGGCGTTCAGATGGACAGAGTAGACAGTTCTCGGTTGCAGGAAACAGAGCAGTTTATCCAGCAGCAGCCC
CCGCAAAGAGAATCGTGTTATCCCGCCGAAAGCTGTCAACCCAGTAGTAGCAAAGAAATAAGTACGTCGACGCAAGCAGGCAGGTCAAGCCACGATGATA
CTTTCTTGGACAGCGACGCGAGGCATTTTTCCACAAACACAGCGCCCGCTGTTACTGACGTACCTGCTGGCTCAGATGCCACATGTGTCGCAGCCCTTGT
GAATACAACCACATGTACCACGAGCCCGGCTCGTGATGTTTCTGCTGGCTTTGATGCCACACATGACAACACGCTTGTGAATACAACCACGTGTACCACA
AGCCCGGCTCCTGATGTTTGTGCTAGCCCTGATGCTACTCAAGCTAAAGCTCGTGCGAATACGAGCACATGCATCACGATCTTGACTGAAGATCGAATAA
AGAAGGAGGTAGATATGGGGACACAGGGACCAAATGATACACGGTCGAGATCACCTATTCGGCCCTCTAGAGCTGCTGTAGTCCCTGGGGTATCGCTGGC
ATCACACGCAGCGCGTCTTCTGACTATGCAAGATATACTAAATGGTGAGGATGGGTCTAGCAAGACGAGTATGCCAAGACTTCAACTTCTAGATGGCAAG
CAAAAGCAGGGGTCGTACAAGCGCAAGATGCCAACGACAAGCA