Description :
From Genome Similarity Track
Location :
contig_78:157317- 158449
Transcript NameFunction/comments
g12559.t1hypothetical protein

Sequence
1132 bases(100 bases per row)
GTCACCTTTATGCAGTTCTGGAATCGAGGATGCTACCGCAGTGGGTCTTGGAGCTCCAGTTTGAAGATGCTGCTCGGAATCGCTCGATCACATACCACGA
CTTGTGTCCGCACACGCCGATGATCTTCTTCAACCACTACTGGGAGGGAGCACTAGACGCACCTAACTGGCCAGCAGCTAAGCCATTCTACCTCATGCCC
AACATCGAAATGTACGAGCTGGAGAGCATGCACTACTGGCGGGCCGACGTTATTTTGTGCAAGACAGCGCTGTGTGCTCGATACTTGAGGAAGTGGCTTA
GTCAAGAGGGGAATCCTCGAGGCACGCGCGTTGTTTACACGCGTCACACGACAACGAACCTGGCACTGGCTACCAAGAGTGAATTGAGCGCGAGGAAAGC
GAACGAACTGTCGAGCAAGAACTTTTCAGACATTTCGTTCTTGCACACAGCAGGCAAAAGCATTCAAAAAGGGACGCGGCAAATCTTGGATTGCTGGCTG
GGCCAACCCGAGTTCCCGCGGCTGGACTTCTACATGGACCAAGAGCTCTACGACGGCGAGTTCGGCGACTACGAAGAGCGGATCAGTGAAAGTAGCAACA
TTTACCTGCACACAGGCCAGTTGTCGTCTGGAGAATTCGGACGCGTGATCACTCAAGGCCGCTACTTCTTGTGCACCAGCATGATGGAGGGCTACGGACA
CTATATTAACCAAGCGCGTTCTGCAAATGCGTTTATCATCACGACGGATGCTGCACCTATGAATGAATTGATCACGCCGTCGTCGGGTGCACTGGTCAAA
GCTCGAACGATCGCGTACGGGGAGCAGTTCATGGGTGGGGTATCTGACAAGGAACACGCACTACGCAATATCTCAGGACTCGTAGCAAAGTTTGAAAGAG
AGGATGTGTGTGACACTGTCGTCAATCTCTTGAAGAACTCGACGTCCGAAGAGCGGGAACTGCGCGCCAACCGTGCGCTTCAGCAATATTACTTCGACAC
GGTCTTCTTCGCGCACAAGATGAACGAGTTGCGGACTTTCGCTCGCGCCATGAGCCACCCAAGCCTTCGTGGCAAGATTCTGAACGGCGGATCATCGATC
GCGTAGCTGGTAGTGTGTGACAAGCTCAGAGC