Description :
From Genome Similarity Track
Location :
Scaffold_166:157231- 158789
Transcript NameFunction/comments
Phyin_T30-4PITG_20265Putative uncharacterized protein

Sequence
1558 bases(100 bases per row)
CTACAAGATCACCCATACCTTCCTCGAGCGTCCAATAACCTACGAGAGACTTGCATTTAGCCACGTGAAGAATGGACGCAGCATTATGTTGGATCTGCTG
GATACTACGACATTCGTTCCAGTAGCGGATCTCCTGAATAAAACCCTGGAACGACTCTGTCTTTTCTTTAGTGCCGATTCTGCTCATGGGCAGGTCGAAT
ACGCCTCTACGGGTGGTCTTGAAATCGCCATTAAGGAAGAGACTGAGCTCCTTGGAGCCAGCAGAAAGCACGACGTGGTTCCAGCGATTCCGTTCCAGCC
GAGTGTGGAAATTCACTTCTCTTGCTGCTTTCGTTCCCGATGGACGGTAGAAAACGATCTCGCCTTTGGCTCCAGACACGAGAGCGATGACGTTTTTCGG
ACTCGACGCGATGATATGGCGGCCACAGCGTTCAAGAAGTCGCGACGACTTGTTCTCAGACACGAGCGACAACTTGGCTTCCACTTTTGCAATTTCACGT
TCGTATCTGCGTTGCAACCTCTGAGCCTCGGGATCATCAGGATCTAGTGCTTCTAACTGTGTCTGAAACTCACTGCGTTTCTTAAGAAGATTATTCTGTT
CTGCAGCTTGGCGTTGACGTCCGGCTTTGTCTTCTTTGATCGGACTTTGCGGTGTGAGCTGCTTTGCCCAAGCTTCCAAGCTGCTTAGCAGGGATCGCTC
AGCGTCAGATAGTAATTGCACCAGCAGCATCCTCTCATTCAAGAAGTGAGCAGTTTGGTCGACAATCGCGGTGAAAACTGCTCGTTGTGCTTCCTCGTCA
GTTACGTCAGTGTCTAGAATCCGCTTAGCTTCGACGATGTTGAGCTTGATCCAGCCTTGAGCCAACGCGATCTCCTCTCGCGTCTCTAGTAATCCATTCT
CGGCGTTATTGAAATCTTCCGCCAGTTCTTTCGCTGCGATTGCCAGTTCCTCACCGGACAGGTGCATTCCTGTTGTTTTATCATAGGGTCTGCGCTTACG
CTGTTGCTTCAACACCCTCAGTTTCTTCTTACAGGCGTCCGACTTGGCTTGCCATTGAGTGTGTTCCCGCTTGTGAATCGCAACAATTTCCGTCCACTCC
AAGCTGCTTCTGTGCAGTGATAGGATTTCTTCTTCTGCGTCGACCATCCACACGTAGAATTCTGCAGTCCAAGGCGGCGGTAGATCGATAGATGGAGCCT
GGTTTATTGTGCTATTGTTGTGAATGAATATGTACGCGTTTCCTCCCGTCTTGAACTGCAGCATACTGCGATCCTTAGACAGAGTCATAACGTCTTCGTG
TAAGTGCCGATCTCGCCATCGAAGACGCGCTTTACAGCCATGAGCGGCATTCTTGCATGGAACAACGCGACTGACGCATTCATCTTTGAAATGTCGAGTG
AGATGCCGCAACCGGACCACCACTCTACACTCTGGACACGCCACGGGTGAGTTCTTCTCGCGGGCTCTCGCTGCCAGAGTATTCCGCTCTATCGTCACGA
TGCAAGCGGTACGAATGTGCTCGTCGAGTTTCCCCACAGGGACCCACTCTTGGCATCC