Description :
From Genome Similarity Track
Location :
contig_24:157213- 158773
Transcript NameFunction/comments
g5362.t1RAW38555.1 hypothetical protein PC110_g5204 [Phytophthora cactorum

Sequence
1560 bases(100 bases per row)
ACTCAGCCGACTGGGTCGCCGACCACGAACGCACCCTGTGCTACGTCTGTACGAGGCCCTTTGGGACCTTCCGTCGCAAACACCACTGCCGCATGGTAAG
ACCGTTGCAGTTTGAAGCTCCCTTCGGGATCCCTGACGCTTGTTTGCTATGCTTTTCCGTTTTGGTTGGCAGTGCGGTGAGGTTGTCTGCAAGAACTGCA
CACTCCACAAAGAGGCTCACTTGGATTCAACAATCGGCCCCACGCGCGTTCGAGTGTGCATGTCCTGCGTGATCAACCACTCTCACCAGCATGACGGACG
TTCACCCGGGGCTCCGTCGCCACATTTCAGTGCGACCTCAGAAGTGTCTCGCCAGTGGCTTCGGAGCCACTTGCACTCGCCGGCATCCGGTCCCTCATCC
GAGCCGGACAGTGAAGAACTCCAACTCCTCTCACTCACACCCAAACCACGCCAACACTTTGAGCTTGACGATAGTCACTTCAACGCGGAAGGCGAGACCA
GAAAAACTCACCAAATAAATCTGCAGGTCGAGCAGGACAGCAACGAACTATCATCTCAGTGGGCTCACCCATGGCCTCGACCACCAGTGAGCATCGATGA
AGAAGCCCGACTTCGAGCCTTGTACGCGCTTGGTGTGCTGGACTCCGAATCGGAAAAACCCTTCGACATGATCTGCGACTTGGCCAAGGCGCGTTTGTCC
TGCGCCATGGCTGCGGTGAGCTTCTTGGATGAGCACCGACAATGGTTCAAGGCTAGCGTGGGTCTGGCACACAAGATGATCCCGCGCAAAATTGCCTTTT
GCGCCTACACGGTGTTCAGTCGCGAGCCGATGGTCGTACTGGACACGCTTCAGGACCCTCGATTCCGAAGAAACCCGCTCGTCTCGGGTGCTGCCGGCGT
GCGCTTCTACGCTGCTGCGCCTATCCTGGACCCGAACTCGGGTCACGCCGTCGGAAGCGTCTTCGTCCTGGACACACGTCCCCGTGAAGCGTGCGATATC
TCCATTCTGGAGCGACTGGCCTTAGCTGCTGGCGAAAACCTCCCAGAGATCGCAACAACCGCTGCGATGGCCGAAAACGAACAGAAGGCCGAGCTGGATA
ACAATGCTGCCGAGAAGTTCGAGAGGCGCCAAGATGACAATCAAGTAGATGGTGTCAGCAACATCGTTCACGTTGCGGTGCAAAACGAGCTCCAAAGCTT
TGGCAGGAAGACAATCGGAGTGCCGATGTCTCCAGCGACGTCAGCTTCAACATCTTCAATGTCATCGGTCGCATCCGGATCGTTCGCAACTCAAGTCTCG
TTGGCCAAACCGAAGGACAACGACGACGTCAACGAGAACCAAACTGAAGATAGCTCGTTGGCCATGACGCAGCTTTCCATGGGGAAGACGGCAGCGGGTG
AGCAGATGGAGGTGCTTCTCATGCGCCTGCTGACACAAAACACCGAGACGCAGCAGCAACTAGCGGTGCAGCAGATTTCGCTGACGGCGAAGCTGGGGCA
GCACACCGACCAGATCAACAAGCTCATGTCCGACTTCGCACGAATGGAGGCAAAGGTCGA