Description :
From Genome Similarity Track
Location :
Scaffold_245:15720- 19316
Transcript NameFunction/comments
Phyag_g3904conserved hypothetical protein
Phyag_g3905hypothetical protein PHYSODRAFT_445842

Sequence
3596 bases(100 bases per row)
GGCGATGGCCACACCGGCTACACCCACGATGCCCACCGCGGCACCGATAATGCCCCCCAGGAAGGCGGGCTTGCTGCCGTTCTCCTGGATCCACTCCTTG
GCTTCGGCAGCGTAAGACACAGTCTCCTCCTTAGTCTCAGTGGCAGCGGCcgcttcctccttcttgttctcctctTGGGGCTGTGCAGCGTCCTGTTGCG
TTTGCTCGGGCTgagcctccttcttggcgtgCTTCTTGGCACCCTTGATAAtgtccacgtccacgttgCCCTTGTGGACGCGCAGATGGATGGACTTGGC
TCCCTCGGGCACGTCGATGATCTCATCCACAACCTCGTCATCCTCGAACTCAAGTTCCTGGCTgtagtcctcgtcgtcgtcaatctCCAGGTCCACCGAG
CCGTTCGTGAACTCGATGTCCGTGTCCATCTGACCGCTGGCGTCCAGACTGGCCGAGGCCGAGAAGTCCAGGTCGCCCGAGGACGAGATGTCCAGCGTCT
GGTCGCCCTCGCCGCTGTAGTCCAGGCCCTCGCCGTTGTCCAGatccacgtccacgtcggccgagccgtccacgtccagaTCCAAGTCCTTCGAGCTCTC
GATATCCATCTCCTCCGAGCCCTTGAGCTCCACATCGGCCGAGTCCGAGTTGTCCAGGTCGTACGAGTCGTACGAGTCAGACGAGTCAGACGAACCGCTG
TCCGGCTTGGGTTGCTCGGGCGCGCCCTTGTTgggctgctccaccaccttgggCGCGTATTTGGTCGTGTGGTGGATGCCAGCCAGTCCGCGGCGCGGGT
GCGTGCGCAGGGCCGTGGTGGACGCCATCTCCGAGGCGGCGAGCGCCGACACGcacagcgccagcgccagggTCTTCTTCACAGACAGCACCATGATGAT
CTCAACTCACGCGACGGATAGCACGCAATTCCTGTAGTGAGTTCAAAGGGCTAGCCGAAGAGAAAAATCAGGTTCAGCGTGAACCCACGGGTTTCAGCAC
ATTTCACTTGCTCTTTGTATGAAACGGGTTTGAGAGGGACGAAAGAGGCACACTGTACCGGATACGCCCAGCCAAATCAGCTCAAAGGTCAACCCGCAAA
AGATatcatggcggcggcggcttctcTCAGGAGACGGACGGCCTGGAGACGCCGAACTCAGTGAGTTGGGCTTCTTCACACCTCCTTTATTGCATGGGAT
CGTTGTTGGCTATGCTGTACAAGTTGTGCAGCCTCCGATCCAGTACCCGTGACTCTGCGGACATGccaaagttgctgcatccaCTCGTCCGCACCGAGTG
GACAAGTCCTCGCCACACACGCATTATGATTCGAGCACAAGAGCAAAGAACTTGCCGTGCTTCGCCGATGTGCAAGCTAGAAATCACTTTTGAAAAGTCT
GTATCAAGTTGCCTCTCACGGActccgtggctatccgaatagcgTCGCTGCATCTGCCCCAAGCTGTTGATCAGGCTGTTGGATCTATTACCCAAGACCA
GcgctagcaggactccctGATGTAGGATCGCCAGTGCGAACACGCCCACGTCCTTGTGGAAGAcgttccgtgctgcgttagcatgTCGATCTTcgaccag
gtggcagtgcttgcattTGTACATCTTGGCGCCGAACTTTTCGTCGATGAGTCCACGCCCCGAGTACGTCTTGGAAGTGTACGCTTCGTGCACATTCACC
ATTCGCCCACTCGTTCTCTGCGtcttgtactccagcatcttcttgaggttgtAGTGCGACGGCGGCGCAGCTTCCGTTTGTTGCCACGaaacaagctgaa
gaagtgtGGCAGACTGATGCAGCAGGGTTCTACTGCTCGATGTTGtcgccgtcacctccgccaTCAGTTTACGAAAAGTTGCAGTTGACTTCCAGCTGTC
AAGCACTGCCATTCTCCAATTCCCTTGTAGACAACACAGCAGCCGTGGGCGACGATGCCTTCAATCGTGTGCAGCCTTCCATAATCCAGTAATGCATAGG
CATGACTTCCAAAAGGAGCAATGGTGCCTCGCACCTAATCGAACAACGACGGTTATCCACATCCACATCAAGCTGCACGCACCCGAGCGATGCCTGGGCA
GAACGTGACGATCGAGTTCCTGCAGAGCCTGAGCGatggcggcaagaaggaggcgctgcagtccGCCATGGCGTGGTGCTCcaccaaggagctgcgcaGT
TTCTGCAGCGGCATGGGCGTGCGGGTGCGCAGCAAGGAATACGCAGTGTATCACACCAAGGCGGGCtacacggagctgctgacccAACTCCTGAGAGCCA
AAAGCGCGGATAAGGGGCTCGCAGTGGGGCCCGCGCCCCCGCCGATCGTTGTGACGCCCATACAGCGCACGAGGAAGACCAAGAACTGCAATCTGCGCCT
GCTCAACGTGCTCTGCTCCGAGTCCATGGCCCCTTATCTCAGCGGGATGAACGCAGAGCCAACGCCGACGGAGGTGGAATCTGGAGCAGTGGGAGGCAAC
AATCCTTTCTGGACCAGGTTCCGAGTCGAGTTTATCAGCAGCAAACCCGAATACAGTCGGGTGGCCTTTCAGGGATCCTGCCTCTCGGGCTTCGACCTGT
CCACACCAGTGCcgcactccagcagcaaactcagcGACATGTGGGCGGAGCTCTGGGGGGCGTATAATAGTGCACTCCTCCGCTTCACGCACTCCACAGA
CCCCAAGTTGGAATTCGTGGACTGCTGTCCCAGTCGGAGCGACGTGTTCTACATGCGATGTTGGCTCAATGCCAAGTCGGACGTATTGTCGGACATCTGC
GTGAAAGTACCGGCAAGTATTGCGCTGGACAGCATTGCAGTTGATTCATCGGCGAGTGCAAGCGAAGAGGTTGCGCCTGTCAtagctgctggagcggaGC
GCGTTGAGCTCACGACGCCGTCACGAAAGCGCCCACGCGTCCTCATGAAGCGACCGATGAGAGGGGTCGAGTCGGTGGCAACTTTCACCCACACGCCGGG
CAAGGACGCGGAGAGAGCATTCTTGCTGCAGTCAATTAGGCATGCGGCGGAGATATTGACGTTGTCGCGTGGATCGGAGCTTGGGCTTGAAGTCATGGAA
ACTGTACGatgcgagctgcagcagtgcacgAAGCGTTTGAAGAGGATCCAACAGGAAGGAaaccaggacgacgaggagacagaggaggagatggagggTC
CCTAGCCTGCCTGCACTACAGCTGCCGCCAGTCACGCCTCAGGATTTGAATTTCATGATCCACTTACTAAGAGTTGCCGTTGCCATGAAGAGAATTGAAA
TTTGCGCTTTGGACATTCCAGTAGCTATGCGATGATGCCTCAGTACTCGGGGAATTTGGGATTTTCATTGGAGGTCACTGCTGCCCGTGAAGAACGTCGC
TTACACCAAAAGAGTTTGTTTGGAAGCTGAATCTACCAAACCTCGCGCCaagataaaaaaaaaaaggaGAAGTGTTGGTCCGTTGTTGCAGAACAGCGCC
GAGAAGAGGGCTCTGTTCTTGATGGAAGACGTGGCGATTTCGTAAATGAAATCTGGGGTATATATGAATCGTGGTGAAGTGGAGTGTGGGGTGCTG