Description :
From Genome Similarity Track
Location :
Scaffold_758:1572- 3051
Transcript NameFunction/comments
Phymu_g11858hypothetical protein PHYSODRAFT_517932
Phymu_g11859Amino Acid/Auxin Permease (AAAP) Family

Sequence
1479 bases(100 bases per row)
AGAACGACGTGTACTACAACTACACGGCGGAGCACGAGGGCTAGACTTCAAAATGTGTAAAGTGTTGCTACTTGGTCAGCAATATTCCAATGTTAATGAA
ATGTTTCAAGCTAAAGCAAACGTTGTTGTATTGGTATATGGTTTGACACTAACATCACTTTAAGGTTGGACCAGCACCCCTTAGCTCTCGTGAACAGCAG
TGTAGTTGTAGTACACATTGTTCTCGAACTCCGGCGCGCAGAACGGGAAGGACGTATCATCGTCACTGGGGACAAACAGGTTCTTACCCGACGTGTACGT
CACATAGCAACCCAGGCAGAAGCACACCACGACTACGGTCAGCGCTGGAGCCTTCTCCCACATCGGCAGTGAAGtccatttcttcttcagtagGAAAACA
ATCGGCAGAAGGATCGAGTTCACCGTGATGCACGAGGCACCCGCGAAGTCCGCCAAATCCGAGAAGTGGTCCTTCAGAAGAACCGACGCGATGACCAAAA
TCACGATCATCACGATGCGGAGAATCACGTACTTGATAGCGTTGGCGCCGCGATActcagcagcctcagcaTCCGGTTCACCAAGGTGCACGTTTTCGTT
GTCGGCAACCGAGATGAATGAACGCTTCGAAACACGGGATTCCTTCTCCGAGtgttcagcagcatcagcaggAGTGGCAGCATCAGCATAACTCAGCATA
TTGCTCTCAACATCAGCGACGGGGGCCTTGTGCATTCCAAGCACAATGCGCTCGGCAATGTAGAAGGCCGGGTTTAGgatgacggagaaggcgatcgTAA
TGTGCAGCTGCATGAAGATGTAGGCGAGGACGACAGCACCCCAGTCCGAACGGAAACCGAGCGTGGTCAAGCCGGTATCGGCGTCCGGGTAGATCGACCA
AAGCAAGTTGCCCGAGATTTGACATCCCACCGACGAGTACGCAGTACTGGCAAGAaccaggaagcagcacgaaaTGAACGCGATGGTCACACCGACAACA
CGGGGCATGCGCGTGGGGTCGCTAtgttgacgctgaagcgccGGAATCACGATACCGGCACCGTAGGCAAGGGCCAAATTGCCGaaagcaccagcgactt
gcTTGAATTCGAGATCAGGCGATGGTACACTGGGGTGGCCACGCATGCCGTACATGACGACGGCGACTCCGATGGCATCAGCGATAAGCGTCCCCATGCA
GCCAGCGAaggcagcgccagcaccttcctTGAGAGTGGGCACCAGGCAAACAGGTAGGCAAGCGAGGGCCATCAGAATGATCCACACAGAACCACTGAAA
GCGCCCGGGAAGAGGCCGTCCAGTAGCGTACCACCAAGCACGAGGAACACGCACGGCACCAGCAGACAGTTGCCCATTTGAGAGATGACCGAAAGGTAAC
GGCCTGGTTTGCCCATGCACCACTCGCCAAGGTCACCGTAGGTCCTCACTGACCGGGGGGCGAGAAGCATAACACGGCA