Description :
From Genome Similarity Track
Location :
Scaffold_234:15715- 17162
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.20Protein phosphatase PP2A regulatory subunit B

Sequence
1447 bases(100 bases per row)
AGCTCTGGAAGGTCTGCGAGCGCAACGTGCGTGAGGTCACGCAGTACAACGCGCAGGCACTAGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAACGCGCACACGTACCACATC
AACTCGATCGCGCTCAACTCGGACGGCGAGACGTTCATGTCAGCCGACGACCTACGCGTCAACCTCTGGAGCCTNNNNNNNNNNGGACCAGAGCTTCAGT
GCGTCCTTGCGCTCTGTATTTGCATAGTGGTCTTTTGATCGTGGGCGACTTACGGTGGCGGTTCTTGTGTTTTGCTCGCGTAGACATTGTGGACATCAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTCACGGAGGTGATCACAGCCGCGGACTTCCACCCGTCTCACTGCAATATCATGATGTACAGCACGAGCC
GCGGCGCGATCAAACTCGGCGATATGCGGCAGGCTGCGCTCTGCGACTCGTACTGCAAAGGTAAGAAGACTCTGGTGCGCTCGCCCTTGAATGAAACTCG
AGCACCTGACGCACACACTCTTTTTTATTCACGATGTCACAGTCTACGAAGAGCAGGAAGACCCCGAGGCCCGCAGTTTCTTCTCCGAGATCATCGCGTC
GATCTCCGACATCAAGTTCTCGCCCGACGGCCGGTACATCATCGCGCGCGATTTCCTCACGCTCAAGATCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACTCAAAACCTGTGCAGACCATCAATGTGCGAAATTGGAAAGCTCCCTTACCAGGTTGCATGTCTCCTCTGGACTCTGGACTAACGCC
GTGTTGACTTTATCCTTTTAGATCNNNNNNNNNNCACGAGCATCTGCGTCCGCGTCTGGGCGATCTGTACGAGAGCGACTGCATCTTCGACAAGTTTGAG
TGCGCCGTGAGCGGCGACGGCAACAATTTCATCACGGGCTCGTACAACAGCGAACTCCATATTTATGACCGCTACGGCCGCAGCGACATCTGTATGTCGC
CCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTCACGTGAC
GCCGCAGGCGGAAAGCACCGACGCGCTCGACTTTTCGAGGAAAGTGCTGCAGACCAGTTGGCACCCGACGAAAAACGAAGTCGCCGTCTCCATTCGCAAC
AATCTCTACGTCTACAGCACGTGATGGGAGCCCGAACAGGAAAATCGCAGGTTTATACAAAGCATCAAGTGGAAATGTACGCGCTGCTATGAAATGAAAA
CAAGGCAAGAAAGCGATAATTCATGCAACACGAGCTCAGGAAAAGAA