Description :
From Genome Similarity Track
Location :
Scaffold_5:157139- 160366
Transcript NameFunction/comments
Physo_511451Hypothetical protein
Physo_334476secreted RxLR effector peptide protein, putative

Sequence
3227 bases(100 bases per row)
CAGCTCAAGGACGCCATGATGCGCGCGTAGAATATTGCCGGGTGCATTAGGTGATGCCTTGACTCAAGGCATCACTCTTGGCAAATGCGTAACCCCCATA
TGCTGTTGCATATGGGGGTTACGCATTTGCCAAGAGTATTGATATGAGGCCGGCAGAGGCAGGTGGCCCAGCTGACGCTTTGACGCTCTTCTTGAGCTGC
AGCCGAGATCAGAGCGGCACCACCTCCTACACTTACCAGCGGTCGACGTCGGGTCGTCGCCCCGGCTAACGCCCGGACGTCCAAAAGTCGTCGAGGGACA
CCCAGTCGACATCCAAAAGCATGTCACTATTGCGAAATAGGATCCTTAAGACACCGCGAGGTGGCGCACCCTGCATTAGCCTCATTGAGGGACGTGAGTA
CATACACATAATGTAGACTGGTAGTAAAGCGCGTTCTCAGTGAAACTGAGAGGGGCAACTTCTCCGCTATAGATCGCGATAGGGTCGGGTACAAACACTG
CCGACGTTATAATGCTTGCGATGACCTACATGTGAGCCCGTGTTCCACTCAATCAATCTCGTAATTGGATCTAGAGATGTATGCAGTTGCGCAACTCCCA
GACGACAAAGGAACCATTGAAGGCGCGTCATGGTCTGGTGTATTCGGCCCAGCCGGAGACGACGCCTTTGACAACATGGCTGGCGCTGACACTCAAGTCG
CTGTCTGAGCGCAGTCAACACTTGCTAGGGCGTCTCATGCAAGCTACTCAGCTTAGATCAGCGTCCACCCCATATTTTGTAGTTCATCCGGGGCATGGAC
ATCCCATCGTTCAGGCAGACTCGCTGCTAGCTGGTCTACAGTGTAGACCAAAGGTGTAGACTCTACAGCATTCGATAGCGGAGCTCTTCCAAGTGAAAAT
CATTATCGTACTTGGCTGTTTGTTTGAGTCGCGGATACAAGTTGATTGAGGCAATGGGCACGTCTGAGGTCAGGAGATTTCATTGGCTTCACCAAAACTC
CTTTTGACCAATCAGCAGAAAGTCGAGCGGAGGATGTCGGCTCGACTCGAGCGGACCCACGGACGTCGACAGAAAAAGACGTCGGGTCAAGGTCAAAACC
CTCGACGTCGACAGCTCTAGCTGTTACCCATAGCGTTTCGTCGCGCTACGGTGTCTTACCTGATACTGTACACGACCCTCGAGCAATGAGTACAGCTCCA
GATGCCAAACCTCCAGCTGTGCTGCATAACTTGCGCTTGATTCCGGCCCCAGTTGCTGTCGTGCTCGAGTGAGTACTGTTTGGATCGTGTGAGCCTCCAC
CTCGCCTCCTATGCCTCTTGGCAGCACCACACATCCCTCACGTCCGCTCTTCATTCCCGCACTTGCTCCATCGCCAGCACCCCCACATACAGTACATTCC
AACGGAACCCAACAATGAAGGGCCGATTCATCGTCAACCCCTTCCAAGAGCTCAACTTGACCGCCGCCGATCGAACCTCCCTCGAAGACCTGGCTAACCA
ATGCATCACCACCAACCTCCAGCTCTGCATGAAGTACATGTCGGGCTCAAAGCGTTCGGTCGACCCGCACCACTGGAAGCCGTTGAAGGAGAAGGAGAAG
CTTAAGGTCTACACCGAACGCCCCGAGGGAGCCGCGTCCGCGATTGCGTCCGGTAACGGTCCCACAGGCTCCGGACTACCTATGATCCTGTGCGTCGGCA
CCATGGAAGGCAAGCTGGAAGACCTTATGTTCGGAGTCATCAGCGAAGACCTTGAGACGATGCGCGTCAAGGCCTCGTACGTCGAGGATTTCAGTGGCGC
GGCTGTGCTGGATTCCGTCGTGATGCCAACGCTCGAGGACCCGTTCCAGTCGCTCGTGATCAAGTGGATGGAGCTCGATATCCCCTTCCACTCGACTAGT
CTGGTCAAGAACCGCGATTACGTCTACCTCGAGGGAACGGGCTACATCACCACTCCGCAGGGCGAGCGCATGGGCTATCACTTGCTACACTCCGTCAACT
TCCCACAGACTCACGCGCTGCCGAACCGTGTTCGCGGTAACCTCTCCATCGTCGGCTTTTGGCGACAGATCGGCCCGAATAACATGGAGATGTACGCGAC
TGGAGTTATGGACCCGGTTGACTCTGGCTTGGTGCGTAGGCTGGTGATCCCGAACATGGCGAATGTGTTCCTGTCCACGTTGAAGTACGCGTACTGCGGT
CAGATGCGTAAGTTGTCGTTCATGCTGGACAAGGCTTACACCGACTCGAAGCTGCACGGCGCTCCGAACAAGAAGAGCGTCTGTGTCACCTGTTCGGCAC
CGATCTCGGGGCGGAAGCTTGGGGACTTCGGCAAGAGCAACAGCACGTGCAAGTTGTGCTTCGGGTTTGTGTGTCACGCGTGTAAGATCAGCCGGAAGCT
GAGCTTCGTTGACCCGGACATGCTGCTGTCGCAGCGGAAGGTGACGTTCTGCACGGCGTGCATCAGCTCCGTCACTAGTGTCAGCTCTGTGGACTGCGCG
AAGGCGTTGCTGCTCAAGAACCACAGGGCCACCCACTATAGTTTCGAGCAAACGCTTTCGTCCGAAGGCAGCGGCGAGTATTCCTACGCGAGCACGCAGT
AGGCGTTAGATTACAGAGTTGTGCTCGCCGTGGACACGAGGTTTTAGGCACTGAATGAATGAATATGCTTTATCTTATCGGAGTATTTGAACCATTCATC
AAACGATACCATCACGGAATCAATGTTTTACTCGATAACCATCATGCCATTGACGTATCAAGCGGTAATGGAGAGCTGAAATGCGTCACGAAATCATTTT
CGTCGCCATATAGAGCCAGATGGACTGCGTGTCTTCCTACGAGGGATCATTTGGGGGATCGGATAGGTGAATCGCAACCTCACTTGGCAATCTTTGGGCC
AACCGCCTCGTCAGCCATGCGGCAATTCTTCACCCCTCTCCTCCTTCTCGTCACTTTCGCTGCTACAGCTTCGGCCGACGTGAATGGAAGTTCGACTTCG
CCTAGCTTGAAAATTGACTCCGCAGGCGGCGAGACTGCTCGGGATGCTATCGAAGCTAAAAAATCCTGTAGCAGGATTCAAATTTCGGAAGACTGAGGAG
GAAAAACAAATTGCAATGTGGCTGAAGGAGAAGAAAACACCGCTCGAGGTCTTCAATTCCCTGGGGTTGGATACAGGAACGAAGAATCTTCTAACGAACC
CGAAGCTCAAGACTTGGAGTTTCTTCG