Description :
From Genome Similarity Track
Location :
contig_78:157099- 158192
Transcript NameFunction/comments
g10185.t1hypothetical protein

Sequence
1093 bases(100 bases per row)
CGCCGATGATCTTCTTCAACCACTACTGGGAGGGAGCACTAACGCACGCAACTGGCCAGCAGCTAAGCCATTCTACCTCATGCCCAACATCGAAATGTAC
GAGCTGGAGAGCATGCACTACTGGCGGGCCGACGTTATTTTGTGCAAGACAGCGCTGTGTGCTCGATACTTGAGGAAGTGGCTTAGTCAAGAGGGGAATC
CTCGAGGCACGCGCGTTGTTTACACGCGTCACACGACAACGAACCTGGCACTGGCTACCAAGAGTGAATTGAGCGCGAGGAAAGCGAACGAACTGTCGAG
CAAGAACTTTTCAGACATTTCGTTCTTGCACACAGCAGGCAAAAGCATTCAAAAAGGGACGCGGCAAATCTTGGATTGCTGGCTGGGCCAACCCGAGTTC
CCGCGGCTGGACTTCTACATGGACCAAGAGCTCTACGACGGCGAGTTCGGCGACTACGAAGAGCGGATCAGTGAAAGTAGCAACATTTACCTGCACACAG
GCCAGTTGTCGTCTGGAGAATTCGGACGCGTGATCACTCAAGGCCGCTACTTCTTGTGCACCAGCATGATGGAGGGCTACGGACACTATATTAACCAAGC
GCGTTCTGCAAATGCGTTTATCATCACGACGGATGCTGCACCTATGAATGAATTGATCACGCCGTCGTCGGGTGCACTGGTCAAAGCTCGAACGATCGCG
TACGGGGAGCAGTTCATGGGTGGGGTATCTGACAAGGAACACGCACTACGCAATATCTCAGGACTCGTAGCAAAGTTTGAAAGAGAGGATGTGTGTGACA
CTGTCGTCAATCTCTTGAAGAACTCGACGTCCGAAGAGCGGGAACTGCGCGCCAACCGTGCGCTTCAGCAATATTACTTCGACACGGTCTTCTTCGCGCA
CAAGATGAACGAGTTGCGGACTTTCGCTCGCGCCATGAGCCACCCAAGCCTTCGTGGCAAGATTCTGAACGGCGGATCATCGATCGCGTAGCTGGTAGTG
TGTGACAAGCTCAGAGCGACGAAGAAACTCGGTACTGACCAAATCGAGCTCCCTCCATGGCTTCGAAGAGAGACAGATAGATAACGTGTATTT