Description :
From Genome Similarity Track
Location :
Scaffold_104:157080- 158930
Transcript NameFunction/comments
Sapdi_VS20SDRG_15896hypothetical protein

Sequence
1850 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCAAAGTACAAGGCGAACGTGGCCTTGAGCTCCTCGACGTACGCGCGGTTCTCCATCCACGACTGGAACGCGAGCGAGTTGGCGC
GCAGAATGTCCCAGGGCTGCACACCAGCAGGCGACGGCACGTCCGTGCGCGACGAGAAGCCGGCCATGAGGGTCGACTGGACCTCTTTCGAGACGACCCA
GTTGACAAAGAGCTTGGCGGCCGCGGGGTGCGGCGCCTTGTTGAGAATTGCGATGCGCTGGCCCCACGCGAGGTAGTCGGACGTCGCGTTGGGTCCGGCA
ATGACCTTGGTCGTGTTGGTGTACGACGGGCCGCCCGCGACACCGATCGCTTTGGTCTGCGCCGTGACGGCGACGCCGGCCATGTGCGAGCCGCGCTGGA
AGAAGATCTGCTGCGCCGCCATCTTCTTGACCCAGTCCCAGCCGTACGCCTTGACGTAGCGGTCGTACACGAAGAGAGCCGCGTCATCGTCGTGCGGGTA
GGACGACGCAATGAGACCCGCGTACTTGGGGTCCGCGAGGTCTTTGGCGGTCGCTGGCGGCGCGAGGCCCTTGGCCTGCAACAACGCCTCGTCGTAAAAG
TAGCTGAACGAGTAGACGCCGTGCGAGAGCCACGCGCCGTCGGGGTCCGTGAAGCCCTTGTAGACGCTGCTGAAACCCTTGGGCTTGTACGAGAGGAGCT
TGCCTTCCTTCTTCCAGCGCGGGTAGTCCTGAAGAGTTTGGAGCGCGACAACGTCCGCGACGAGCGAGTTGGTCGCGAGCTGGTTGTCGATGCGCGCGTT
GTGGTACTTGCTATAGTCGACGACCATGGTGAGGTTGACCTTCGGGAACGCGGCGCGGAAGGCGTCGGCGACAAAGGCTTGCTGTGCGGCAAAGTCGCCG
CCGTGGTACACGACGAGGTTGCCGCCTTCCGTGACGGCGTCCTTGTAGAGCTGCGCCACGGACTTGGTTTCCTCCGAGACGGCGCACGGGGACGGCGCGG
CGACGACAAGCATCACCGGAAGCGAGGCGAGGAGGCGGAAGAGCTGCATG