Description :
From Genome Similarity Track
Location :
Scaffold_14:157075- 158791
Sequence
1716 bases(100 bases per row)
CCAAATAATGTTTTTGGGTTAAAATGAGACCTGCTATTTTTGTTTTATGCTTTCTGACTTCCTCTAAATGTAATATTCTAATTTAGGAATCTGCCAACGG
TTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAAAGATGCTTCTTTCAGCCAATAGGAACCCTAAGTCTCTATGGACCACCCGTCATG
GTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTTACACCAAGATCGAAAAAGTCTTTCGAACCTCTAACAGGCGCCGTGTCTGTTAGAGTTACAAGTGA
CTGTAGCCACTTGTGCGTGTAACCCTGTTAACCCCCCGTCAAGGTTAGACGCGACGAATCACGGCACGTCAATCAAGAAATTGACCACTCGTCAATTCTT
CACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGATCGCCGAAGGAGAAGACCGCCGCTGCAGCAAAGGAGAAGACCTCCGCCGGGACAGAGA
ATCTCTCTGTCCCCGAGTAGTCAGGAAGCAAAGCGTGACGCTCTTGCTGCCAAGGCTGCGGCGGGGACAACCCAGCCCGGGATCGTCCTCGAAGGCTCTT
CCGTAGTCAACGACGCTATTGACTACGAGGACGGAGACGTGGGGATGGAGGAGGGCGAGGCCTCGTCAAGCAAGCGCAAGGAGTCTATCGACAGCGATAG
TCTCGACCCACATGCCGGGTCGAAACGCCCTCGTGAGGAAGACGACTCGGAAGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGTGACACTCCGCTCTCT
GCTGCTGGGGCTTTCAGCTCCCCAGGCGCTACAGCGACTTCAAGTTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCCGTCCGCGACTGAGA
TCGCGGCACGGGTGGGCAATACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGCATCCGCGACGATGCTGTGGCGGAGGAGCAGCACTTTGA
TCCGTTAACGAATCAAAGGCGCGACTACTAAATCGGGCTCTTCCATGAGCTCCGGTATTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAG
TGGCAGGCACTTTGTCAAGGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAATCCGACCGCTTACCGCGAGCGGGTTAAGCATGCCCGTGAACGCTTCG
AGACGTTCTCGACGCGCGGGCGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCATGCGCTGTGCCCGAAGGTCAACAGTGCACGTTGTA
TCTTCTGGGTGCGGCGCGCTTGAGCGACCACGACCTAAACGGGTACACAACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTCCTGGCA
CGCGAGGAACACGACGATCGTGGGACTTCGGGCGCTGCAGGTGACTACAGCGCTCGCACTACCTTCGCGCCGGCAGTGCGTCGTGAGCTTCGTACACCCT
CACCATTTCCGGAACGTCCTGTAGCAGGACGTCTCGCGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGC
CGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCGGTCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGC
CCCGGGTATGGTCAAC