Description :
From Genome Similarity Track
Location :
Scaffold_316:15707- 16955
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_316-snap-gene-0.12Hypothetical leucine rich repeat calmodulin binding protein

Sequence
1248 bases(100 bases per row)
CGCTCCACGAGGTTGTCGCGACGATCCCGCAGCTCCGTGGCCTGCAGCTCAACGGGTGCACGCACATCACGGACGCTGGGCTCTGGGCGATCGCGCGCCA
ATGCCCGCAACTAGACACGATCCACTTGGCGCAATGCGCGCGCGTGACCGAGCTCGGACTGCGGCTGCTCGCGCACAACNNNNNNNNNNCACTTGGACTC
GTGGAGCTCAGCGAGTGCCCTCAGATCACGGACACTGTGCTGCAGACGCTCGCAGCGGGCTGCTGGACGCTGCATACGTTGGTCCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCACGTCGACGT
CTCCGAGTGCGAACACGTGGGCGAGTACGGCGACAAGGCGCTGGTCGAGATCGGCAAGTGGTGCCCACAGCTGACCCACTTGGACCTCTTTGGGTGTCGA
CACGTCCACGACGCAGGCGTACGCGCCATTGCGCGAGGATGTCCATTGCTCACGACACTGAAGCTCACAGGGTGCCGCGACGTGAGCAGCATCGCAATCC
AGGCGCTGGCGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGACCAAGTGCAAAGCGCTCACGTGGCTCGATATCAGCGGATCGCCCAACATTGACGCGGTCGGAGTTCGCGCTCTGGCGCAGTATTGCA
AGCAACTCACATACCTGAACCTCTCGGATTGCCAGCGGGTCAACGATGCAGCGCTCGAGGCGCTTTCCGCCAGCAGTGCGACCGCAAAGAGCGTGTTTTC
GTCGTCGCTGTCGTCGCCATTGGCGACGCTCGNNNNNNNNNNTCCGCGGATCACCGAAACTGGAGTCGCTAGGCTCACGAGGGCGTGCACGAACCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCGATCTTACCGACTGCGCGCAGATCGGACGCCGGTTCCTGCAAAAGCTGATCCATGAGCTC
GCGTTTGTCGAGTGGGCCGCGACGTTCTTTGGTTTCCAGCCNNNNNNNNNNTTCCAAACGCCGCAGAACTGTGCAAACAGCGCGATCGACGCATTCTCGA
GTGGAAAAGCGCCGTCAAGATCCAGGCGGTGATGCGTGGCTGCCTCGC