Description :
From Genome Similarity Track
Location :
Scaffold_351:15707- 16929
Transcript NameFunction/comments
Hyaar_Emoy2813852conserved unknown protein

Sequence
1222 bases(100 bases per row)
GTGACTCGGGGCATCCGCGAAGTAGGATTGCAAGATAAATGCACGCGAGAGCAACGGTTCGATCTCATTCTCCACCCAGTCTTTTGTCGGCAAATTTTGC
AGAAAAAGCACCAGGTCCTGGAACTCCAGTGTCTTCAGTGTCTCGCCAAACGTCATCAAAATCGCAGCGCACACATACACATGAAAGCTCTCAAAGCCCG
AGTCTTCACATAGATACGTATCCCAAATGCGCACGATGCCATTTAGTGGTAACTCGCGCATCAATAAACAATTCATCCAGCGGAATGCGAACTGAACAAA
CTGCACATTTTCACGCTCCACTATATGCTCGAACAATTCTGCGTCACAACGATGAACCAATTCTTCCATGCGCTGCACCATGCGCTGCAGACCCGGCTGT
GCGAAAGTGTAGTGGTCCTGGATATCGTCCAATAGTTTCGTCAAACACCAGTAGCTATCCGCCTCAACAACTTGCAAGTTCGCGTCCGACACTTTTGACA
AGTCGCACATCTGCGGGTCAACTAAGTATCGAAGATGTGTCAGCTAATGAGCCTGACAAACTGAACCACGACACCCACTTACCGATGAAAGCCGAAATAA
ATACGACCAAGAATGGCGTCATGAGGTCATTAATTCCTTGCACGTATCCACTTGCCGGGTGCCGGATTGCCCAAATATAAAGAACTCGTTCCATGCACTA
TAAAGACATGCTCACACACGCAGCTTGTCAATGTAATCGCTCGACAGTCTCATAGTGACCATACCGTCTTACTTGGTGAACGCGCTCATTCTGAAACAGC
TTCACGTCTGCGTTTGTCCGTGGAATATCAACGAGGATCTGACGCAGCGTAGTTTGCTCTCGCATTCCCCGGTCGGTGTCTGGAATGTAATAATACTGCT
GCAGCAACTCAACATACTCTTGTCGCTTGCGCTCCAACATAGCAGCACGCCGATCTTTTATCGACGGCATGTAGCCCTGTAGCCACATATACACAATGTA
CCGCAAAAACAGTCAGCACCATGTAGTCGTACATCGCACTTACATACGACAGTCATCCTACCAGCAACAGCCGCCAGACGGTCGGCTGATGCTTCGTCGG
GACACCACCCCAGCTGAGTTTGCGAAGCTTGTCCAGATCCACAACTTCCTGTTCCAGCAACCGTTCAAACTGCATATCGCGGAGGTTGCCAGATGCATTG
CGTGATAACGACGACGTCGACG