Description :
From Genome Similarity Track
Location :
contig_24:157064- 158624
Transcript NameFunction/comments
g4532.t1hypothetical protein PHMEG_000470

Sequence
1560 bases(100 bases per row)
ACTCAGCCGACTGGGTCGCCGACCACGAACGCACCCTGTGCTACGTCTGTACGAGGCCCTTTGGGACCTTCCGTCGCAAACACCACTGCCGCATGGTAAG
ACCGTTGCAGTTTGAAGCTCCCTTCGGGATCCCTGACGCTTGTTTGCTATGCTTTTCCGTTTTGGTTGGCAGTGCGGTGAGGTTGTCTGCAAGAACTGCA
CACTCCACAAAGAGGCTCACTTGGATTCAACAATCGGCCCCACGCGCGTTCGAGTGTGCATGTCCTGCGTGATCAACCACTCTCACCAGCATGACGGACG
TTCACCCGGGGCTCCGTCGCCACATTTCAGTGCGACCTCAGAAGTGTCTCGCCAGTGGCTTCGGAGCCACTTGCACTCGCCGGCATCCGGTCCCTCATCC
GAGCCGGACAGTGAAGAACTCCAACTCCTCTCACTCACACCCAAACCACGCCAACACTTTGAGCTTGACGATAGTCACTTCAACGCGGAAGGCGAGACCA
GAAAAACTCACCAAATAAATCTGCAGGTCGAGCAGGACAGCAACGAACTATCATCTCAGTGGGCTCACCCATGGCCTCGACCACCAGTGAGCATCGATGA
AGAAGCCCGACTTCGAGCCTTGTACGCGCTTGGTGTGCTGGACTCCGAATCGGAAAAACCCTTCGACATGATCTGCGACTTGGCCAAGGCGCGTTTGTCC
TGCGCCATGGCTGCGGTGAGCTTCTTGGATGAGCACCGACAATGGTTCAAGGCTAGCGTGGGTCTGGCACACAAGATGATCCCGCGCAAAATTGCCTTTT
GCGCCTACACGGTGTTCAGTCGCGAGCCGATGGTCGTACTGGACACGCTTCAGGACCCTCGATTCCGAAGAAACCCGCTCGTCTCGGGTGCTGCCGGCGT
GCGCTTCTACGCTGCTGCGCCTATCCTGGACCCGAACTCGGGTCACGCCGTCGGAAGCGTCTTCGTCCTGGACACACGTCCCCGTGAAGCGTGCGATATC
TCCATTCTGGAGCGACTGGCCTTAGCTGCTGGCGAAAACCTCCCAGAGATCGCAACAACCGCTGCGATGGCCGAAAACGAACAGAAGGCCGAGCTGGATA
ACAATGCTGCCGAGAAGTTCGAGAGGCGCCAAGATGACAATCAAGTAGATGGTGTCAGCAACATCGTTCACGTTGCGGTGCAAAACGAGCTCCAAAGCTT
TGGCAGGAAGACAATCGGAGTGCCGATGTCTCCAGCGACGTCAGCTTCAACATCTTCAATGTCATCGGTCGCATCCGGATCGTTCGCAACTCAAGTCTCG
TTGGCCAAACCGAAGGACAACGACGACGTCAACGAGAACCAAACTGAAGATAGCTCGTTGGCCATGACGCAGCTTTCCATGGGGAAGACGGCAGCGGGTG
AGCAGATGGAGGTGCTTCTCATGCGCCTGCTAACACAAAACACCGAGACGCAGCAGCAACTAGCGGTGCAGCAGATTTCGCTGACGGCGAAGCTGGGGCA
GCACACCGACCAGATCAACAAGCTCATGTCCGACTTCGCACGAATGGAGGCAAAGGTCGA