Description :
From Genome Similarity Track
Location :
contig_18:157048- 158597
Transcript NameFunction/comments
g3710.t1hypothetical protein

Sequence
1549 bases(100 bases per row)
ATAGCGCATTCCGCAAGATTCTTCGGCTGTCGGCTACCGCTCGACGAACGATGATACGGGAGAAATCGTCACCTTCGTGGGAGTTGACAGTGATCGAGTT
GTGTCAGCTTACAAGCTTGGGATGTGGTGCATCGTGGCGCCACTGATGTTGATCGCTGTGAGCGTCCTGATTGGAACGCAGATGGGGATTTCTGTCGCTC
TGGCTGCTGCAGCGGCAAAAGTGATGACCATATACGGAGCTCTCGCGATGTCCAAGCAGATCGGACTCTACCGCCGCCAAATTTCCCGCATTGGTGCAAA
CCGACTGAAGCTGACGAACGAGATGTTGCAAGGCATTCGAGTGGTCAAGTTCTACGGATGGGAAGACTTTGCCAACGAGTTGATTCACGAAATTCGCCAG
AAAGAGATCGGTCTGCTGCGCAAGTACAATCGTCTGCGCCTCGCTAACACGGTATTGATGTTCTTGGCACCAACACTACTCAACTTGGTCTGCTTTACTA
CCACAATTGCGCTGGGCAATAGCTTGGACGTGGCGACGACGTTTGTTATCCTGGCACTCACCAATGCATGCCGTACACCCTTCAGTATTTTTGCGGATGC
ATCGATGGCCGTAGCAGAGGCGATCACATCCACCAGTCGGCTGTCAGATTTTCTCGCTGCGGGGGAGAGCTCTCAGGATATCAAGCTAGACACTAATCGA
GGTGCGTTACCGTTAATCTCGATCGAAAATGGCGACTTCCGATGGGAAGACGAAGCCACTGCGCCGACACTCTCGAATATCAACCTCACGCTCCAACCTG
GTACTCTTACTGTGGTCGTGGGGGCTGTTGGTAGCGGTAAAACTAGCCTCGTCAATGCAATTCTCGGCGAGATGCAGCAAGTTCGCGGGACGCGTGTGGT
TCGTGGAGACATCGCATACGCGAGCCAACAAGCGTGGATCCAGCACCAAACAGTGCGCGAAAATATTCTCTTTGGTGAACCTTACGATGAAGAGCACTAT
CGCCAAGTGATCGCAGCGTGCCAACTAGCCCCAGATTTTGCGATGTTGGAGCAGGGTGACCAGACAGAGATTGGCGAACGCGGCATTAACCTTAGTGGAG
GCCAGAAGGCTCGGGTTAGCGTGGCTCGGGCAATGTATCGTGCTCACAAGTTCGATTTTGTTGTTCTGGATGATCCGCTGAGTGCCCTTGATGTTCACGT
GGCGAACGCGGTGTTTTCAGATGGATTGGCCGGTATCGCGCAGGGCAAAACTCGTGTACTAGTGCTGAACTCGCACTACCATTTACTGCAACACGCTGAC
CGTGTACTGGTGATGTCAAATGGACAAATTGTAGGTGACGGATCATTACTGGAAGTGCAGGAACAGTTTCCATTCCTGCTGCCTTCGCTTCGCGCTAGTG
AATCACGAAGCAGTGAACTGTCAGACTGTAATGAAGACATTGAGGAGCCAGCACGAGCTATCGTCGTTGTGGGAGGCGAAGAGGTGGGCAAAGCGAAGAA
TGCCTCTTCTGGAAAGCTGGTCACTCAAGAGGATCGGCTCGTTGGGTCG