Description :
From Genome Similarity Track
Location :
scaffold_645:15702- 16884
Transcript NameFunction/comments
g9664.t1hypothetical protein

Sequence
1182 bases(100 bases per row)
TGATATCGTAGCGCCCTGAGTTAAAGCCAAGGACTGGTACCTGATCTAAAGTTTGCTTGCTCTTACCGTAGTCCGACCGCTTCTTACCAAAGCCGAGCTT
GTTGTGGAAATCAAAGAAGCTGGCAAAATTTCCAGACCGGATCCAAGCATCCACATCTTGTGTCTTGTACGTATTACCAAGAGAAACACCTGGAATCTCC
ATACCTGTCAAACCTTGTGCGTCAATAATCTTACGAAGCAAGGCCTCATACTTGGAGACATTGTATTGCTGGATCTTCGCTCCGACAACATTGATGTACT
GGAACATATCCTTTAGCAATTCCTTCGGATTATCATTTACAAAGCAACGCACCTCCTCCGTCAAGCTATCGGCTATGGAGACTGACACCGGGATGTGTTC
GTTCTTGAAGACAGTATTCTCCCCGTGTTGAGTCGCCGTAGGCTTAAGAATAGCCTCAAAGTCATACACCACAAAGTGATCTATGTAGTGATCTATTTTC
TTGATAGAGTACTTCGTCAGTAGCGAACGGATTGTATTCGACGCTGGACGATAGATAGTTGGTTCTTCAGGGAATGATTCAATATTTACGAGCTCACACT
GGTTCTTCTTATGGTTTCGGAGCTTGTCAGAGCTGACAAATACCATCTCACACTTGGAGCATTGGTACTTGCACTGGAGCATATCAATATTCTTGATGTA
GAGAGCGTGATTCTCGTGAGATAGAATATTGATAGCATCGTATGCCTTGTCCGAACGTCAGATGCATTCAACCTTCCCTGTTTCCACATCCATGGTGAAT
ACATTGATGTTCAGTTGAAAGCAGTCCTCAAGCTCATCGAACAGGAGAATGTCAATTGGTTTGAAACTGCGAAACAGACTTAGGGAATATTTGATTCCCT
TGTACGAACAGTACTGCTTGAATGCTTGCTTTACCAGAGATTGGATTCTCCGCAGATCTTTTTTGGAGTCCTCTTGCTTGTGGAACGCGATGCAGTGAAA
TACGCACTTGTTGTTAGTCTTAGGGAAATTAATTACACTCTTGTTGTCGCGGATAACCTTCGGAATGACGGCTTCACTATCACCCAGTGCGTGCTCGCGC
TGGTAAATGAAAATCTTGAATCCAGTGATTGCCTTGACGAGGTATCCAGACTTGGGGTAGTTGAGCTTGTCAGCTAATTCCA