Description :
From Genome Similarity Track
Location :
Scaffold_410:15701- 20550
Transcript NameFunction/comments
Phyta_totarag8038hypothetical protein PHYSODRAFT_475074
Phyta_totarag8039hypothetical protein PHYSODRAFT_293744
Phyta_totarag8040conserved hypothetical protein

Sequence
4849 bases(100 bases per row)
GTTTGTTGGATACCGCAGCTGTGGTCTGCGAACAACAAACTTCAAAACGGAAAGGAGAGCGtaacgtacatgtagaacacATTAACAGATCCAGTACACG
TTATCGAGCATAAACCACGAGAACATGCGAGCGATGGGCCTTCAGTGAAAAGCTTTTGTTGCACGGTACACAGCTAACGCAATCAACGATTATTTGATCA
TCCGGAGATCGGTTGATGCTGGACAGGATGTGCATGTATAATACCGTGCCTTCAGAAGAGGTGTTCGTCCTTCTTTTCGTGTAGAAAGCACCTTGGGAAA
TGTGACTTGCAGGAATCGCTGGTACACCATGTCAAAGAATTTTTCGCTGTTCTGGTTGAGTTAGATCAGCCGTATCCTTTGGCAGTCAAAGGAAGTACTC
CTCATACTTCTGCTCATAGATAATGCAGAATCGCCGGTCTGGGGTCCGACGAACGCGATGCAGCGTTCCTGGGATGCGACCTTGCGTGGCTCGATTCAAG
GCATGACCACAGAAGAGTACAATCTCCTTCCCGGGAACGCACACCTTCTCTGCCTTAAGCCACTGCTTGGAGTGTGGGTCATACACATCCAACCCCTCCA
CACTGGGCACAGGTTCCACCACGTACAGACTCGGATCCACATGCTCGAAAACGTTCTCCGTATCGGATTGACCACTTCCCTCAATGTTCGGGTAGTGTAA
TCCGTAGCAAACGGAGAAGTCCTTGTCCGAGCGTGCGTGGCTAGGCTCGATATCATAACCAACTGTCAAGCTCAGCGCTCGATCGCAAATGCGCTGCATG
CCGCGCTGCAGAGACAGCCAGTTGTTCTTGAACTCGGGCGACGGCCACACCAGCCGCGACATGTCCCCACAAGCCACGCGGAAGCAGTCGCGCACACTCG
TGTGCTCATAGCCAGCGTACCAGAACGGTTTGCTGTGCTCGTTGCGGTAGACGTGCTTGCTGGTGCACCCGTTCTTCcagtcctcgtcgtcgctcgtgAA
GAACGTCTCGAAGTCCCGGAGCACTTGGTCGTGGGTGTGTTCCAGCGTCTCACCGAGCTCTGTGAGCACCACGAACGAGTGACGTTCCATCATCTCCAAG
AACCGGGCGCGGTTCTTCCAGTTGAGTTCAATCAGTCGCAGACGCGGCACTTGCACGGCATCGTCGGAAACGTGTTCGGGGGTCTTTGCAACGGCCTCAC
TTGGTCTCGGCACCTCGGTATCGTTGGTATCTGAAACGGTGTCGTCGGCAACTTCGCCGCTTGCATTGAGACAGTAGTAACTAGCTGCCAGACTGTAACT
GGTGGGCATGGGGAagcctgcagcagtcgaggTGGCCGTCATGACGGTGGTGGCGAACGAGGGGGATACTGCACACGAATGACTGCGACTCCTGGCCTTG
ATCAAGTTTTTGTGTCAGAGAACGGGAGCCACACATTTAGCGTGCGCACAGCCAATCAGAGACGGCAATAGAAAAgggaccatcactcctggAGTGCTGC
ATGTTGCAGTTCAACAGCGCTGGTTGTAAGACGTggtacagtaatctgcgttGTAGTGGAGTGTGTACAAATCTACTAATAATTTTATGGTATAAGTTAT
CGTGGCGCTCGCGTGGTTGGCACGAAAACATGTAGCTAGAAGATGCGCAAGGGGGCACTAGCAAGAGAGAGGCTTAGACACAGGTGTGATGGGGGGTTGA
GTGTCTTTGCGATGCCGTAGTCTTTGTCTTAGCTGTGTGCGCCTGGTCGTTCTCCTTGGAATCGAATAGCCGTGACCGCACCTTGTCCAGATGACCCTGC
CACTCCGGCGTGCGCGGCTTCCGTGcagtcttgctgctggcaagGTTGCGGTTGCGCTCTTCTagctggcgacggcgttCCACGTTCCTGGCCTTCGTGG
CCACGTAGCGCGGCGAACTGTCGTAGTCCATGTATCTTGCGGCAGGCGATGAATTCGAGTCGCTCCTCGTAGATGGGGAAGAAGCCACAGCATGCCGTGC
TGATTTGGAGGAACGACGCATTGACTTGACCACCACCGGCACCATCGTAGCTGAGAGTGAAGAGCGACGAGGCCTCGATGGTGTTGGTGCAGCTGGGGAT
GGGTTCTTGGAAGCGTAGAGCGAGTAGCGGCGCGACTTGGGGGCTGGGATAGTTGATTCTTTCGTCATGGTGGATGACGATCTGGCGAGCAAACCACGCC
GGTATGAGGTCGGCGGGACTAACTTGGAGGTTGTCGACGATTGGAGGTACTCAGGGAGTGTGGAACGTCTCGAGCGGTAGACGGCAGGTTTGATAATCTT
GGAGACTTCGGCGCTGGTCTCGCCTGATGCCTGCAGTAGCTCGGGCAGAAAGATATCCAGCGAGCTGAGAAGCGAGTCCAGAGAGCCCGTAGAGGCGGTA
GAATATGCCGACGGGCTGCGAGGCACCATCGAGTAGCAAGTAGACTTGGTCGTAGTCATCGAGTCCGTGTCGCTCTCGTCTTCGTAGGAGTTTAGGCTGT
TGgcgtcatcctcgtcatcggACTCCAGGGTCTTGACAGTGAGGCTCATGTAGACAGCAAGCTTCGTCGGGGTCGTTGGCTTTGCAATTGGGgtgtcttc
ctcctctgaTAGTTCCTCGCCAGGCTCAGCAACCTCCTCTGTATTTTGGATCATTTGCACGGGTTCCGACTGGGTGCGGGTGCGCTGTGCGTTTATGCGT
TCGATAGTTTCGATGATTTCCTTCACCGGTAAATTGACAGACTTTGGCTGTGTCGTCGTCATGGATCCGGACACGGACCAAGTGCGTGGAGCCGTGGGAG
TGGCGTTGGCCTGTTCCATGAGTTCGAACTGGTCGATGAGCATCTGCACGCTCGTGGTGCCGTCCATTTGGATTGGATTTGCTTTCGGTGAGCCGACTAA
GACAATGCAAGCGTTACCCAAAATCGAGGGGGAAGTCTCGATTGCCAGAATCTCGTTCGTGTGAGCCCTCGGGGGTGAAAGCGCAACTGGCAAACGACTT
TTGCGGCGGTCGACACTGCACGAGTTTTGGCGTGCGGCTCACGCGGTTTCAGAGCCCTCGGTTGGCTTTTCCAGACCCGTTCTGGCCCCGCCTGGACTCG
TGCAGTGCGTCGCGGAGCGGCAGATAGACGGCGGCCGGCAAGTTCTGGACTGCGGGATAAAACGCTTGGTGGCGAGCGGCTTCAACTGCGCTAGCCAATG
AGGAGTCGCGATATTTGAAATCTTGAGGCGCGAAGCAAAGATACACATGCCTTCCATACAGCATGAACTGATATATAGAATAACATGATCCAAGAGATCT
CCTATAAATCGAATTCTCATAAACATAAACCTATGAAACATAATGCATGTCATATCCACCAAAAATGATGATGTGTCCAGCGACATATGGTGTGACAAAA
ATTCGATTTTCGGCTGTCAGTCCTGCCCGAAACTGTCAATCAGAGAACGGATCCTGTCACATTCGGGTAAGTGCAGGACAGGATTCTAAGGTTAGGAccc
cacttcaacgtcaactcAATGTCCAGTGGACATTGTCCACAGTTACTGCATGGCAGAATCCTTATCGCTTGAAACGCTACGTCTGACTTGGTGCAGCTGC
CAGTCCGAACGGAGCACCGGGTCATTTGCTCCGTCGCTGGGCACCGCGTTCCTTTGCCGGCAAACGGGAGCCGCCTAGGCGTCGGACCTCGGGGACAGTT
TCTTGCGGCGTTCTCGCTCCTTGCTGATTTGTTCCTGCACGAAACGGCCAAAGGATTCGGCCAGGTCGTCGATGCGCTTCTCATGCTCGTGGTTCTGCGC
CGAgagctcgcgctccagccgcagcacTTGGTTCTCTAGAGTCGCGATCACAcccgccttctccttcaagATGGTGGCGCTCTCCTCGGCCGCGATCTTT
GCGCTGGCAGTCACAGCCTAGAAACAAATCAAGAGCAATAAGAGAGTGCAAGACGGGAAGCTCAGACAGCAAGCGGGCGCACCTGAATCCGTTCGTCGAA
GGTTgcctgcatctgcacgaGTCTGGCGTCTTGCTCCTCCACTTTCCgcacctggagctgcagcttctcttCGCATCGAGATCTCTCGCTCACCGCTGCA
GCTagcagcgtctgcttctcctgcagcgtTTTAGACTGCGTTTCCATCGCGGTTTCCAGCTCGCTCTGCTTTTCATTTCTCGATTGCTGTAGCGAGACAT
TGTcctgacggagctggagaatCGTCTCGAGGTGCTTTTCCACCTCTCGCTCGAGATGCTGtcgcgccttcttcacctcggCGACTTGAGCCTCAACCGA
CCCGACCGAGCGCTGGATGCGCTCCTGCATCTCAGCctcccactgctgcttcaggtcTCCGATAGTCTTTTCGTGGTCAATTTGAGACAGCAGAAGCTTG
GCTTGCAGGGCTTCGCTCTTTTCCTTTAGCTCTCGCACACTTCGCTCGCTTGCTTCAAGCTGTGTGGAGGTGTAACTTAGCTGTGTCTGTACAGACCCAA
CAACCATGTCATGCTGTCGCTGGGCCGCGCTTAAACTGCCTTCGTGGTCCGACGTCAGCTTGGCTTCCTTGCGAGCATACTCCTGCTGTGCatcttgcag
ctgcttctgtaGCTTCCCaacttctgcttcttgcgtcCTGCGCAGCACGTAAGCAACTAAGTCCAGCGACATCGCAATGGTTGAGTTAATCAAAAGAGTG
TTACCTAATCGTGAGAGACGTGCGGTGCATCTCGTTGTCGAGCGCATACTTGGCCACTTCCAGTTGCGCTATCTGCTTGTCTTTCTGCTCTGCTTCCTTG
TTGCGTAAAGCCTCCATGTGGCCCATTTTCTCTCGAATAGCACCATTCT