Description :
From Genome Similarity Track
Location :
Scaffold_850:1570- 3845
Transcript NameFunction/comments
Phyke_g11558hypothetical protein

Sequence
2275 bases(100 bases per row)
NTTCGTTGAGGACCCCTGACTTGTGAAGTGTGCGCATGTGCTTCAGGACATTGTGGCTGCCTCGAGCCGTTATCTTGTGTTCCAGGAGAAACGTCGACCG
CTCTTTCTCAGCAATGGAGCCAAGTTCGAGTACATCGTCGCGGTAGCGTGAAGGATTGGTATCGATCAGGAAGCCAGCACtaaggaagagcttcaagaaa
cCCACGATCCATTTAGTGTTGGACCTCACGTGTTTGGTTGCCTTCTCCTTAGAGCTCCACATGCGAGGCTCTTGTGCGTACCAGCTGAACCACGCATCTC
TTATGTTTGTCGTTTCTGATGCGTGTCGTCTCTTTGCTGAGGGctcattgctgcttgtgttcTCACCATCTTCGTTTGTTGTTTGTGCGTGTTGTGCTGC
GTTGTAGACTTTAGCTTTCACGATAGCCAGACGAGCATCGAGACATTAGTTTACCTGGATCAATTGTTCAATCAAGGCTGTTTGACGCTGGAATACTGGG
TGCTCCGTGATGGCTGTAGTTGTGTCTTTCTCCTTCGCGTTGCTACTACAGGCGATGTGAGACGACCaagccagcagctctgcaataGCGTAACCGCACT
CGATGACACAGAGTTCTAGCCTCTCCAATGCAGGTCCCACACAGTTGACGCGCTTCATCAACGGATAATGCAGGATTAGGTACACCGTAAGGGTTTTCAT
CACTCGCATGCTCACGTTATACTGTGATGTTTGCAGACCTGAGCAGGAGTAAAAGAGTGCAGTTGCAACCACCCGAATCTTcgtctgtgtgtgtgaatCG
AACATTTCCAATAAAAGAAGTGACATCGTTTTAGCAGGAGAATGGCTGCTTAAGACCTCCGAAACTTGGTAGTCCTCACTCGGAGTGTTAAAGACATACG
CGAAGGCTTTGTTCGTTGCCGTCATATCCCAAGCGCCGCGATCAAAAATCCACTGGGCGCTGAGACCCGCGCTGTTGGCATGCTGCATGCCGCCACGTTG
AAAAGAGTGTGATGTGCTCGGTCGCCCCAACCTTCTTCATAATCCGCTCAAGAACACGATTGACGTAGCTGTGGACACCAGGCGTGGTCATTGGGGCCTT
GGTAGTCGAAATGTCGGGCGCAGCTTGTGCCAGTGATATTGCTTCTGGATGATCTAGCAGGTCAATTAACGGGGAGGGTGGTGTGAGAGTGGTGGATGTA
AGCAGCTGCTGGCCCGGAAGATGACTTAGTAGAGCAGGCGTCGGTGACGACTGGGTGACCAATGCGAGCGCAATAGCAAGTATTGGACAGGTTGCGAAGT
CATCGTCAGGGAAAAGAGAGAGTCCTTACTCTTCGGTCATCTTGATCCGGATGAATCTTAGAAAGAAGATGTCGTCTGAGCCGATGGATAGTGTCATAGt
tcactactttcaagaagcaaccacttagtccaagtgACTAAGAGGGTATCAGGTTACCCGAGTGGCGTGAGTTCAAAANGTTAGACTTGCGAAGCAGCGT
TAAATCTGACGCTCAGCCAAAAAGGAACCAAAGCAGGCATAGTAGCGCCGCATCTTGATAACCAGCCGCCGTGGAAGCAGTAGAATACAAATGTATGACC
ATTTGCTTGGGTGTCTTCTTCGTACATACTGGAGCTTTATTGGCAAAGCCTCCAGACTCGCACTTCAAGCAATACTGCTTTAGTATCTGACCCTTCTTGA
GCAGACGCGCATCGACAGCGGAATGATGCTGCAAGAGCTGACCCATGAGCCAGTTCTTCGCCTGACGGAAGTACTGCATGATCGAGTGGCGCGCTAGCAG
CTTCCCCTTACGACCCTCCTTGGACGCCAGATGCATGCCAAACTTGTCCACTACCGTTTCCAAGATAAGTGGTGCATTTTCACGCAACATGCACATCTGT
AGATACTCCCAGCTcacgccttcttcttctaagAACTTCATGAAAGAGCGTGACGCGCTGTCACGAGCACGCTTCGTGTTGACAGGAGCGAGATCATCGA
GGCTCATCTTGCGGGTCGGAGGATTGTCAGTAGTTGTGAGATATGCGCGAAATATGCGAATGACTGCTATCTTGTATAGGCATTCCAATAACTTTGCTGT
GTCTCCGACCCGATATGTCGGAGGGGTGGGCACGTGTTTGACCCTCtttgtgattggctgaaacgCAGGATAACTGCTTTCTTATTCGCTAAAAATAAAA
TCATCACTTCCTATTGGTTGAACCTCACGATAGTGAATTTAAGTAAGGTCGGAGAAGTGATGATAATCATCCATA