Description :
From Genome Similarity Track
Location :
Scaffold_1383:157- 3314
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1383-snap-gene-0.4Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_1383-snap-gene-0.5Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_1383-snap-gene-0.6Gene of unknown function

Sequence
3157 bases(100 bases per row)
GCGTGTGGGTATGCTCGTGGAGCGCCTGCAGTGGCAGAAGAAACAGTACGACCTGCTGATCGCCGAGATGAAACGCGTGCGCCATCAGAGCGAGCAGCTC
GTGATGGACAAGCAAGCACTGATGCAGCGCGTGTCGAATTTAGAGGCGAACAAGAGTGTGCTTGTGAATAAAGTGGCGAAATACCAAATCGAACTCAGCC
GGCAGGCTGAACAAGCGCGCCAGACAGCGGTGAATCAGAGCATCATCAATTATCTGAACACGTGCGACGCCGAAGCCATGGAGGAAGAAATCCAGAACCC
AAGAGAACTAATCATGGCGCTCAAGAAAGCTTGTAAGTATTGTGCGTATGCGTGTATGTGTTTGTATCGATCGCCTGCATCCCTAATTTATGATCTATCT
ATGTGTGGCAGGCAAATTCCGTCATGACCAGTATCAAAAGGTTGTCAAGGAGAAGACACGGTTAAAAGCAATGCTCCAGAGCGTCCAGCAGCATCCGCCG
CATCACTCGCAGCAGCAGCAATTGCAACAGAAGGAGGACGATCGCATCGGCAAAGGCAAACTGAAGGGTGGATTTAGCAACGGCAGCAGCAAGCGGCATT
ATTCGATGGACTACGCAAACACAGCGGCGCCGCCGCACCCATTGGAGCTGAAAAAGCGCAAAACCGACCCAAGCAGCCTAAATTCGATGCCAGCATCGTC
ACCCGCAGATTCGTCCGCGCCCGTACATTTCACGCCTCGAAATGAATCAGCTGGTTTCCGCGCAAATGCATACTCAGATGTCTCCGTTCGCCCCGTGACT
GCAGCGAGGCCAACATTTTCCAGAAGCAGCTTCAATCCGAATCAGTACGGCGCATACAACCTCACACCGGCGAACGAACCTTCAGTGCAGATGTCGAACC
ACACGGTGTGCCGAAGAGGGTACGATGAAACAGGCAAGCTGACTAATTTTTTTCTCACAAAAGAGCCCAAACGAGGAGCTGCACACAGCGATCAACAGCA
ACAACAGAAGACAATTCCGAGCATGCAACACTTACTAGGAGTGCAGCATGGAGCGTCGTCCAGTGCTCCAGTGGTGGCGAATCAGCGACCTGTTGGCGAT
CGACGAGAGTACGCGCTCACGAACTGGCTACAGAAAGAATCTGCGTAGACAGATGCGGGGAGCCACCACAGACTGTTTTATGATCTCGTCACGCCACTTG
TTTTAAAGTTATACCTTGTGCTAGTTGCTGTTTTAAATTAATCTTGATTTTCTTGCTTTGTCACGATCTTTATTAGTCTGTTGCTCGAGTATTTCGTTGT
TTATACCCAGAAGCTGTAAAGAAGGCGCGTCTTGAGAGCAGTTGGGTACTCTCCTGTAGCAACCATTGCCTAGCGTCCTTGCATGGAGTAACTCGGCATG
TGATGGTGCTCTTATACTGGATCACGGAGTCGGTTTGACGTCTGAACCTGATACTTTCGATTTGTGGATTTGGGATTGAAGATGCTGAAGCGCGCGCTCA
AGCTTTGTCTAGAAGGTAAGAGAGACATAGACGTCTCAGTGACAACAAAACTGAAGAATAAATGGAGCTCATATTTCACAACGGCAGAGCTGTCTCCTCA
TGCCACATACCTGCTGCTCTCGAGCAAATTGTTGGACTTGTGGGTCTTCTGCTGGAAAAGTCGGACTCGGAATCAGTAGACTCCCGATTTCTTCGATTGA
GAAAAATCGAGTCTCACTTGATGCCACCTTTTCCTTCTCGTCTGCTGGTGGTGATGGTATACCTTCTGGCTCCGGCCGGCTTGATAAGGAGATGCTGGAC
TTTCTCGCGATGCTGCTATTTGATTCTGGTGGAGGCACCGGCGATATGAGTCCGCATATTTGGTATAGCATGGTCGCCAAGGCTTTTAAATTGGACGCTG
TCTGTTTGCTCATGTTGCCAGATCCAATGCCAATTTCGTGTGGATGAAGGATGATGTGAGGGATTAGAATGCGGACAAAGATGAAATTCACGATAACCAC
ATTGAATCTTGAAATGACACTTGACATTGCCTCCGTAGTCGCGGGTGCTGGTTCTGATAGCAACGATCTTGTATCCATTTGGACCACATTTCGCGTTGCG
CCAAACTCGTCGAACTCAAGTACATCCCTCTCCTGTGAAAATATCATATACTGCAGTACACAAACAGAACCATTAGTCCACAACCGGCTATGCTGTTCAC
TAGCAGAGCGATGAAGTCACTTACAGTCTCTGGGAAATATACGCCATCTGAAGTGAGGCGTCTCCAAAACTCCAGGATACCTGCTGGAACATCGTTCTTC
TCGATGGCCTTGGCAATCGCATCGACAATTCCTTTCGCTCGCACTTTTAGTTTCACAAACCTCGCTCCGTCAAGCCCCTTCGTTCCTTGAGTTGATGATC
GAAGTGCAAACAAAGCTCCAAACTTGTTTGACAACCCTTTCGGTGGAGCTCTTGAACTAAGATCAAGGTTGAGTGAAGGCTCTTGGAGGATAGACATCAG
TGGATTGCGAACGATCTTTCCGAGCCAGACGCGAGTAGCACTGGAATAAATGTTCAACATCGACTCAAAATCCTGAGGTTGATAAGGGCATAATATTTCA
CATTCTATTAGGCACGCATTGAATCCGTGCCACAGCGCACCAGATTAATAAAAAACACTTACCTGCATGGCTTTTTCTTTTTGATCAAGTCGCTTTGTGC
GGAGCAGTTTGCGAAGATGGACCAGCAGCAACACAGCATGACTGACAGACCGAAGAATCTGGATTTGCTTCATGGGCTCTGCATCTTCTTCATGGAAAGG
AGAAATAGATTCATTGTCGTGTTCCATCTCCAGTCGCCATCGTGGCTTTCGAATCGCGTTCCTATTCGTGGACGCACGAATCAAGTTTTCAAGCCGCCTT
CGACTTTCAGATCGGTCGCGTTGATTATCTTTATTTGAATCGCCACCTCCCAGTAGATTCTGTTGAGTGCTTGGATTGCTCGTCTTGCCGGTTTTATCCG
GTATTAGCATTACGTCATCGTCAAGATTGCCAGAGTTCTCCAACTTTTCAAGCATCTACATCGCAGTACATAACCATCAGTATAGTAAAAGGAAGCGAGG
ATTACCGAACGCGAGCGAACGTACAAGTTCATCTTCCTCCGTCCATTCAACCTCGGG