Description :
From Genome Similarity Track
Location :
Scaffold_482:157- 2749
Sequence
2592 bases(100 bases per row)
TTACTGTCCACGGATCCGGTGCTTAAGATCCCAACACCGGAGCTGATCGGACCGATTCGAGGCCCTGCGATTGAACCAAGAGCCGCGATAAAAAAGATGG
AAGCGGTAAAACATCTCATTCAGTTGCTACAAGGAGCAGGGGTTTTACCGGGGGCGTTTGACGTTTAGGATCTGATCGACTGCAACCTGGATCGGGTGAA
CACTGCCGGTCGATCACTGTTCGAAATGATGGTCCCACTTACCGGTAATTATGATTCGGCCGACCGTGAACTCACGACCACTGTTAAGGTCGAAGATGAA
GAACATCCTCCGGCTGTGTCGTCGCACTATGCCTCCGCTGAGTCGGATGCGGGTGAAAGCGATGACATGGAGATCAAACGAATGTCGTTGAGACCTTCTG
GAGCAGCACCTTCGCGTGACCACCAAGAGCATACCGCTCCGACCACGATTGCGATGGGTTCACCTACAACGAAAGTCCCTGCTATGGATAAATCCGACCA
GATGCAAATCTACTTTGCAAAAGCCATGGAGAAGTTCTTACACGACCAACACCGTCGAATTACCCGTACGGCGCATGTCGGGCGTCCCTCCCCCGAGTAC
AATGTGTTCGGGGGAGTATGCCGGACACCGACATGGAATCAGCAGACTCACACCATAGTCGCGGCAACTCGTACGACCCTGACGATCTCGATATCGACGA
TCTACCACGACCCCAGTTGGATACTATCTGAGGCCATAACTGGAGGGAAGATTCGCCTTGCAGCGCATGTCTGCGATTGGCAAGCTGAAAGAATTTTCGA
GCCGCGATCACGATGATGACCGTGCTAGAGGATGGATACGCAAGGTCAGGTAAGCATTCCTGCGTGACCAAGCCCCTGACTCGGAGAAGTGTCTGCTTTT
TGGTGATCTGCTAACGGGCGTAGATCGTAACTGGTACTTTCAAATGAGTCGATCGACACGCAAAAAGTGGAGCAATTTAATCTAGAGATTTCTTTTGCAA
TACTGTGGTCACGGCATTTCCGCTGGTAGACAATATTACCACGACTGTGAGCGTGCTGATGAAACGCCGTCGGAATACCTCTATCGACTGAACGTTGCTG
GAATGCGAGCAAAAATTCATGTGAAAGATGAAAATGCCGCTGATCGCCGCGGCCATGTGGAACACTTGATCAAGACACTGGATGATAGAGATCTCAACGA
CTAGCGCTGCTATGATTGGGAGGGGTCGGTAAATTAAGAGATATTTTGCGTGTGTACAAACGGAAACAGAAACGTACAGGGAATACACCGACAGGCTCAA
GCAAGTTCCGCCAGCGATCAGCCTCAACATACATCCCGATACCATCGAAACCAGCCCGATTCGTGCGTACAATCCACGTGGGGGAGATGGCAGTTCTTCG
GAATAATATATGCAGATCAGACTCAGACGAAGAACGACGACGTGTTTACATCGCTACGGCAGACGATCAAACGACGGATCAAACAAGTAAACGTCTGACC
AAGCCAAGATTGGGTGATCAGGATCGTGCAGTAGGACACAAGTCGTGCACTCATTGTGGGTCGAAAAGACATGACGATCGTGGATTCTGGAAATAATTGA
CGTGCCAGAAGTGCGGACGCCGAGGTCACTTCTCTGGCAAGTGTTTCTATGGGTGCGCGGCGTGTGGAGAAGTACACGAAGGAGAAAGGGTTTATAAAAG
CGTTAATCATCTGACCGGCCGGACTTTCAGTACATATGATTTGGATTCTAGTTGTTTGCCTTCAATTGCAAGTAGAGCGACGACCATATGAATACGCACG
ATAACCCACCAAGATGGAACTCAAGTTGTTTCATGGCGAATCACCTGTAAGTATCATACTCCAAACAAGTGGTTCAGACAAGAGAGAGCAGGGGAAAGTC
AACAATGAGGAGGATATCCTACTGTTTGACTCGGGGGCTGAAGTCTCCATCATCGACACCACCTTTTCTTGTAAGATTGGCTGTCATAGATGAAAATCAG
AAGCAGGAATGTGTGTGTATTGGAGAGAATTCATACGTGGATGAAGGCCTCACGAAGGTGAAGATCATGTGAATGGGTAATTAGTCTATAAATTCGATAA
AAGGGCGGTGACCAAGTGGAACAAGAACCGATTCTAGGAATGGACTTTATAGTACCGGCCGGGATACGCCTTGATCATAATGAAGGGACAGTGTGTTTGC
CGGACGAGGTCAGGATTCAACTGTTAGGTAGAAGACCGCAGTGAGGAGCGGAGATACAATAAATTGCCGCGGACAAGAGGTAAGTGGTGATTACGGTGGA
TATATTTGTAAACGTTAATGTTGGTCGGTATACACTACAGTCAAAGTTGTGGTTAACACGTCACTCACGCTGGGTACCTACGGCTACGACTGGACCTGGA
AGGTTGGCTTACCTGCGCTTGACCAATTTGAGCGATCAAGAAGTGATCATCCAACAAGGAACGCTCTTAAAATAATGCCTTTAGGCGGCTATGATACCGC
GATCACCCGGGTATGTTTCCGTAGGGTCACAGCGATATCAGGAGTGGCAGACACTCGTGTTTAAAACAACCATTGAAGAGGAGGAAGAAGCA