Description :
From Genome Similarity Track
Location :
Scaffold_2:156983- 164414
Transcript NameFunction/comments
Phyci_75824Hypothetical protein
Phyci_206995Hypothetical protein
Phyci_456conserved hypothetical protein
Phyci_206811Hypothetical protein
Phyci_404185Hypothetical protein
Phyci_206852cysteine protease family C01A, putative

Sequence
7431 bases(100 bases per row)
AACGACAGAAAGAAACGCCGAGCAACCGGCGAGGAAAGGCGCGGCAAGCCCGCTGGAATCGCGGCGGAAGGCACGGCATAAAGCGATCCCCGCGCGCCAG
GGGCTAACGGACCGCGGCGAATAAGACCCGCTGGCTGCGCGAGCACGCACTTGTCAACTGGCCACGAGCGCGCCGATCGCCCCTCCTCCGTCTGCTGCGT
CGCTGCCGACATGACGCAACGCGAGCTGTCCTCGCTCATGGCGGGCGCCGCCGGCTACACGGAAGCCCAGCTGGTGGTGCTCGTGCTGGGCGTCGTGGTG
GTGGCCGTGGCGCTGCTGTCCTACTTCGTGGTGGCGCCCGAGTACGAGAAGCACCTCGACAAGCAGTACGCGGCGCTCGTGCACGCCTCCTCGGAGCGGC
AGCTGCACAACCAGCAGGCGCACGAGCTGCTGCTCGCGCGCATCAAGCTGCGCAAGCACAAGTCGCTCGGCGCCTGGGACATCGAGTCCGGCTCCAGCGA
CGACGACGGCCTGGGCCGCTGCACGCTGCAGCGCCGCCACTCGCACGTGCGGCCGCCCCCGGCCAGCGTCTCGTCGCCGCGGGACATGATCATCGAGGCG
GCGCAGGTCGCGCGCAGGGAACGCAACGCCCGGCGCCGCAAGAGCGAGAGCGACGCGCTCAAGCAAGCCAACATCCAGCGGGCAGACATGCTGCGCCGCC
GCGTCCTGCTGCGGAAGCTCGAGGAAGAGATCGCGGGGACCGTCAAGGCGAACGAGGAGGCCCAGGCCGCGGCGACCAGCAACAACCCGACCTTGGCCAC
CATACGGAGGCTCTCGAGCAACACGCTCGACCTGAGCGACGACCGGCTCAAGATGCTGCAGGAGCACCCGGCAGACTGCGTCGAAGAGCTGAAGGTGCTC
GCCCGAGCGCAGTCGCCTGCAGCCTCGTCGCCGTTGGTCGATAACTCAACCATGACAAAGAGCAAGTTCGACAGCCCGCCGGACCTCCTCGAAGTGAAGC
GAGCGTTGAACGTGCTGCACGACGTGCTGAGCTTCTACCTGTCGGTGGACCACCGCGACATGAACAAGCTCACGGTGTTCTGCAACTCGTTGCTGCAGCA
CGATGGTCTCAACCGACTGCGAGCGTTCGAGGCGTCACGCGACCAGGACGTGCGCGCGCTGTCGAACTCCATTATCGAGAAGGCGGTGCCCGCCATTTGG
CACTAAGAAGGGCGCGCCTCCTCCTTCCAATTATCTATGAACCCCCGGCTTCCCGGCCCATGTAGAGCTCAAGCAGTGCACCTCTCAAGTATTAGTAAGT
AAGTAAATAGCTCGCCGGAAGCACTTAAGCATGAATAACTACCGTCTCAATCTCGTGCTCAAAATTCATACTTGACATTGTTCACTAGTCGCCGCTCATC
TACTTGTGCTTGAAAGACGCCGCAATCTCTTGCAGCGAGCGCGACAGCACCGTCCGCAGCACCAAACGCGAGATGGATCCACCACAGAGCAGCACTCGGC
CAGCGGCGGACGGCGTGAGCTTGGAGTTCCACAGGATCAGCGTCTTGGCCTGCGCGGGGGCCACCACCGTGGTGTCTGCCACGAACTGTACGAGCCCCAC
GTGGTCGCTCAGCAGCAGTGGGCCGCTCTTCTTGATGCTGTAGCGCACGCTCGAGATCCGGTCCGAGCTGTCAGGTGCGCCCGCCGACAGGATCTGCTCC
TCGACGCCGAGCGACACGAGGCGCCGGTGGCCCACGAGGCCGCGGCCCTCGCCAGGCTTCAACGTGGAACCGCGGCCCACCCACTCCATGCGCAGCCACG
CGTCGAACGCCTCATCCACCGACGCGTTCACGAGCTGCGAGAGCGCCAGCTCCTGGCCGTCATTCTCCGCATAGGCCTCGAAGCCGGCGGCGTCCACGTA
CCGGTCCGCCATCGTCTGCGAGGGAATTCACAAGTGCATACGGAAACGTAAATGGCGGTCCGTGGTTGGCCGTTAATGAGGATGTTGAAGTGGTCGGATA
TCGACGAATGGAAATAGCCCCGTGAGAAGCGTTTTGGCCAATAGCCAATGGCTAATTGTATCCGCCGCGGTTACAAGGGCTCTTGCGGCGCGAGTGTCTC
CGGTGGCGCCAGAGGATCCATCTTCGTGGAGGAGCTGTTGCGCACTTGCGGCGAGCGTGTCCCCATCTTCGTGCAGGAACACCAAGGCTGGCACGCAGTA
CTTTAAGTATGTATTTGAATTTCTTGCCGGAGCAGCGCTCTATGTAGTTCTACGCGTGCAGCCGCTGTCGCTCGCTAGTCCAAGTGCCTAGCGGCCCTGG
AGGCGGCGTTTGCAGCCAGAGTGCCCAAGAAGCCCTGCAGCGCCGAGCGCAGCACGAGCTTGACCAACCCGCCGCAGCAGAGCAGATACCCCAGCGCCGT
GGGCTCCGTCTTGAGCGACCAGATCACGAGCGTCGCCGGCGTGCTCTCGGGCGACGCCGCCACGTCCACGAACTGCACGAAGGCGAGGTGGTTCTGCAGC
GGAAGCAGCCCGAAGTTGCGGATCTTGTAGCAGATGGACGGGATCTTGGAGCGGTCTCGACGCGCAGCCGCAAGACTCGGCCGGCCGCCGTCGCTGTCCA
CCTCCTCGTCGATCGGCAACCCGGCCGACAGAATTTCCTCCTCGATGCCTAGCTCGACGCGGCGTACGTGGCCGACGTAGCCCCGGCCCACGCCCGCGTG
CAGCTCCGAGCCGCCAGCCAGCCAAACTTCCTCCAGCCACGCGTCGAAGACCTCGGAGGGGGAGCCAACGACGCACTCGGACACTACCAGCTCCTGGCCT
TTGTTGCTCTGGTACTCTTCGAAGGCCTGCACGTCCGCATAGCGCGTGGGGTCCAGGTGGCTGCGGCGCATGGAGTGGGGTGCACACACGTACTTGAGAA
CTTCCTGCTGTGGTTCCTCCTGATTTTTGGCCAATGAGATGGCGCGCAGGGATAATGGAGCGCGGGGGATGGTGTCGTGCTGGCTGGAGGCTGTGGACGA
GCTCTCTGGTATTTGGCCTGCTCATTCATTACACTACCGGCTATGAGTTGGTCGCCTGCTTGGCAGTTGACTTGGCTAGCGACCGTAAGAACGTTTTCAG
CGCCGTGCGGAAGATCAGGCGCACAAGTCCGCCGCAGTGCAGCCAGGTGCAGACCCTGGACATTTCGGTCTTCACGGTCCAAACCACGAGGGTCTTCGGC
ATCCGGCCTGCTGTGTCCATCGCGTCGACGAAGCGCACCATGGCGAGGTGGCTTTCGAGCGGGAAGGGGCCAGGCTTGCGCACTCGATAGCAGATTGTCG
GGATCTTGTTGTCGTCCTGGTCGGGTGTTGGCTCTTCGGGTAGCCCCGCCGAGAGGATCTCCTCCTCCACGCCGAGGGGAACACGCCGCACGCTGCCGAC
GTATCCGCGGCCAGCACCTTCGTGCACTTGATCCCCGCCTGCGAGCCAGACATCGCGAATCCACGCATCGAAAACCGCGGAGGGTGAGCCCGCCGCCAGC
TCGGACAACTCGAACTCCTGACCAGCATGGCGTTCGTAAGTCTCCACAGCTTGGGCGTCAATGTAGCGTTCGTTTGTAAGACGGGCAGCCGACTTCATCG
CGCAAGGCAATCGCGCGAGCTGATGAACTCGACTGGGAAGCGCGAGGACCCTTGTGCCTAGGATTTGCACAGTTTCCCAACCGAAAGCTGCGTGAAGGTG
CGAATCACTTGGAAGGATACTTGTCATCAACTCGATTTATTTATTTTATTTTATGGACTTCCTGATAATTTACAGCGTCTCCTTGAAGGCATTTCGTTGA
CGGCTGGCGTAGATAACTCCAATTACAGTGAAGAAGATGGTGGCAACGGCGACCGCGATGCCTAGGATAATCCAGTTATCCGGCGACAATCCAACAAACT
CGACAGCGCCGCCTCCGTCGACCACAGTGCGCGCTGCCCCAGCCAGAGCTCCTGTAGGGATCACAGGGAACACACTGAGCCCACAATTAATCTTCGAGTC
CATGGCCAGCCGCACGAAGCCCTTCTCGCCCCACGACGCGCCGTACGAGTTCTTGAGAACCCAATAGTCTGTGTCGCCACTCGACCCATAGCCGACGAGT
ACCAACGCGTGGTCAATATCTCCGCTGGATGCGAAGTTTCCGTCATTCGGGCACGTGTAAACGCCGCCCTTGTACGCGTCGAAGGACCCGCCTGAGTTAA
TAGCCACCGAGACAGGCTGCTTCTGCAGCGCGAGCTTGAGCAACTCGGTCGCGTCGCTGCTGATATCACAAGACGTCCCCACCACCTGCTCCCACCCAGA
GATGCTCGCAGCAGCATCGTCCGTTGACGAGTTGTCGCAAGCTGCTGCAAGCTTGGCGGCAGATGCCTGCGAGGTGTCCTCTTCGTTGTAAGGCAGGTCC
AGTTGGCTCAACAGGGACCAGTGCAGCTGCGCTGCATCGGCGAAGGCGGCGTGGGTCATGCCTCCATTGCACCCGTTGTTCTTCGAGCCCCAGATCATCT
TGCTCTGCAGCCACGAGGACCCGTCCACGCCTCCTTCAGCCCAGCAGTAGTCGAACGTGGCCGTCATCTCCCTTGAGCTGCACTCCAGGAACTGCTGGGG
CGACAATGACTGCGGCGTTGTGCCTGCGTTCACGACCACCGCCGTCTCGATGCTGTCTGCGGCCGCAAAGGCCCAGCAGCTACCGCACTGATTCTGGCTC
TTGACGTCGGTGCAGATGCTGGTGTTGAGCGAGTTGTCCGTCGAGCACCAGTCCAGCGTCTCGCGCAACTGGAGCGTCGAGTTAACGAGGCGGCGTTGCT
CCGCCAACCGGCGTTGGCGTTGACGCAGCGCCGCCTGATGCTCTTGGCCCACGAAGTCCGAGGGCGACAACCTCCTGTCGCCGTCATGGTACAGGTGTCT
GGAGTTGACGCCCATGGCGTACGAGAAGGCCCAGTCCCGCACCGCCGCGTGCTGGTGTACCTGCTGTAGGTAGTCCACGTGCGCTTCCATCCGGCGCCGG
AACTCGCTCGGGCCCGCGCCCATTCCTTCGTCCTGCAGGAACTGCGTCACCATGGCGTCGGCAGACACCGCTGCGCCGTCGCGATCCGCCCACAGACACC
GCGTGCCCTCGCAGCTCAGCAGCGTGCCGAAGGTGGACGGATCCAGCGCCTGCGTCGCGACGGCCGGCATTGCCAGAGCGAGCCACTTGGTCCAGGTCGG
CGCCATGCTCCCGAGTGCGCGCTCTGCTCAGTTGACCCGCTCGCCGCCTTCCGAATGGCTAGAGCAGGTGGCGGACCACTTGGGGACTGCGGCGGGAGCC
GGAGATGGCCGCTGCGCGAGATGTGGAATTGTGATTGTTGCAGCCTCGTTTGCTGACGGTGTTTGATTGCAGTGGCATACAAACTTCAAGTGTAGGGTGA
GTCAAGCGAGTCTTTTTGCGGTGAAGCAAATGGACCGGGCTGGCACCGGCAGCCGGCAACCACCATCGGTTGCTGTCTATGGGCGGCGGCACTCCATCAT
CGCCTCCGCTCAGGATGACCAGGTTATTGTGGGAACTTTGGGACGAGGGGGTATTCGTTGAAGCATCCCGTGAGTATGGGATGCAATGCATCGTGCATGT
CGACGAGCTGCGTCAAACGCGGCGCGGCTGGCGAGAGGCAAGAGAGCGACCATGCGGCCGCAGGCCTGGATTCTCGGCCACGCTCGCCTCGAACACATGA
ACGCCCTGGTAAGCCCGCCCGGCTTTGGTTTGAAAGAGAGAGCAGGCGCGCTGGCTCGCTTCGTTTTGCGGTAATCAGCATGCAACTTGCACTACATGTA
TTTTAATACGTAGCTGCTGGCGAGTACCGTAGACTACGGTCCGTAGTGGCCTCCAAGCCAGAGCTCAAAAATATAAAACGCTTCCCTGCGTTATCGTCCT
AGCTTGCCGCGGGCGTGTTCGACGCCGCGTACATGGCCGAGTTCTGTGCGCGAAGGGTCTTCAACTTCCGTTGAGAGACCCCGATGCCCACGGCCGTGGT
TACCAGCGTGAACAGAGTGGTCACCGCGGCAACGACGATCCACGACGTTGGGCTGAGCCCAACGAATATCTTGTCGCCGCCGCTGTCAACGCTGGTGCTC
GCCTGGGCACCGGCCTTCGCACCGGTGGGGACGACGGGGAAGACGTTCAACCCGCAGTTGATCTTGGCGTCCGCCACGAGCTTGATGAAGCCGCTGTCGC
CCCACGAGCTGCCGTACGAATTCTTGAGGATCCAGTAATCGCCGACCGATGAGTCGGTGCCGTAGCCCACGAGCAGCAGCGCGTGGTTGAGGTCGTTCTT
GGACGCCATGTCCCCGTTGTTGGGGCAGTTGTAGAACCCGCCGGCGTACTCGCCAAAGCCGCCGTTCGACGTGATAGCCACGGCAATGGGCTGCTTCTCC
AGCGCCGAGCGCAGTAGTGTAGTACAGTTGTTGGAAGCCGTGCAGTCGGCACCCACGATCTGCTCCCATCCCGTAATGCTCGCTGCAGCTTTGTCCGCAC
TAACGGTGCACACGGAAGAAGTGTTGGTAGCAGACGAGCTCCTTGAACTCGAGTCGTCGTAGGGCATGGTCAACTCCGTCACCAGGCCCCAACCATTCTG
AGCGGCGTCCATGAAGGCGCCGTGCGTCATGCCTCCATTGCAGCCGTCGTTCTGCGACTCCCATTTGATCTCGGACTGCATCCAACTGGCGCCGTTCACG
CCGCTGTCCGAGGCCCAGCAATACTCAAACGTTTGGGTCGTCTGCAACGTGCTGCATGTCAGGAATTGCTGCGGCGATAGGGACACAGCCGCCGAAGCGT
TCTCTGCAATGACTACAGCCGTCTCGATCGCGTCCGCGGCAACGAACGACCAGCAACTTCCGCAGCTCTTCTGGCTCTTGACGGGCGAGCAAACACTGTG
GCCCATGGAGTTGTCGCTGTCGCACCAGTTCCAGTACTCCGAGCTGCCGGAGCTGGACACCGTGCTGCTGTTCGTACTGTTTGCTGCAGCCTGGAGGCGG
CGCGCGTGCGCCGAGAAAGCCTCCTGGTCGACGAACTCCTCGGGAGTGAGCTTGCGCTTGGTGGACGAGGTCAAATGGCGCTCGCTCACGCCCATTTGAT
ACGAGAACTCGTGCCCAATATTTTTCGCGTACATGTTCACGTCTGCACGAGAACAGCACCTTGTGAGATGATCGATAGCGACTGCGAACAGCAAAAAAAA
ATCTTACCTTCGATGTACGTCATGTGTTCCTGCAAGTTGCGTCGGTATGCGTCTCTGTCGCTGTAGGCCACGTAGTTGCGCTCGATGAGGAGCTCCCGCA
GTGTGCGCGAGTCCACGACCTCTCCGTTTTCGCCAGCCCAAAGGCACGGCAGGTCAGCCGAGCGAACTGCCGGGCAGTCCACGAGAGCGCCAAGAGATCG
GTCTGTGGTCTGGGCGGCGGCAGCGACAGCA