Description :
From Genome Similarity Track
Location :
Scaffold_19:156954- 157958
Transcript NameFunction/comments
Phyra_76606PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1004 bases(100 bases per row)
TACGGCTTTAGTCGCCCAACGTAAAACGTTGGGTACAAGCGCATGCTGGACGGTATGTCCACTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCAAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCCGCTGTTGCGTCCTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCATCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATGCATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATGAACCGGATATCCTCCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGATGCCTCATGGCATT
CACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCG
TAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGCCTGCGGGTGATCCGCAGTCGACATGAACAACTGCGTCCCAAGAA
GTGTAAACACTTCTCGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATATCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAC
CAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGC
TTGT