Description :
From Genome Similarity Track
Location :
Scaffold_87:156912- 158488
Sequence
1576 bases(100 bases per row)
ATCAAAAGACGCGCTAAACGCATGGTGCGCTGTTGGAATACGGGCGTGCTGATGCGTTCATTGCGCAACGTCGCGACCAAGTTCCGACATGGGTACGAGT
AGGCCGAGGCTTCGTGCACAAGGAACCGCTTAGATGCCACAGGGCTGTCCGCCGTCATAACATGATGAGCCCTCCGATCACGTGGTCGTGGCTCCACTTC
GTCCTGCAGAAGATTGCGGTGAGCGACCTGTATCTGAGCCTCTGGCCACTGTAGTAAACCCTGCTGCTGCGGCTCGTTCTGCTGTGAATGGTATGGGTCT
TGCACATGGCCGTCGAGTGGACTGGTCGAAGCACGAATAGACGTCGGAGACATGCCGAGGTAATTCGTTGACGGCTCCGCTGCAACGGCGCTCGCCTGCG
TTGTTGTCGACGACGCCGGAGATGCCCGCTGAAGGCTCGCTTTCTTGCGAGACTTCTTCGGGTGCGTAGCGGTGGGGTCGCGGACTCCACGAGTGAGAAC
CTCCCACCGGTTCTTGTAGAGGTTGCAGATCGCGGCACGGCTGACGTCGAACTCCTTTGCGAGTGCGACCTGCTTCTCGCCACCGTCGATCCGCGCGATG
ATCTCTTTGCGGGCGCCCTCGCTCAAATATCTCGACGTGCGTTCGCGGCGTGGTGCCGTCGGCGACAGGTCCCCAATGACTTGAACAGGTGATTCCCTGC
CTGCTGTATCGCCTCCTTGAGAGGGCGGCCTTGAGAATCGCTCGTAGGTTGGGAGAGGGTTGGGCTGGGCGTCGCGCTCTTCTTGAGCCAGGTCAAACCG
GTTCGGCCGCGGAAATGAGGTCATATCGGCGCAGTCCTCTGACGACGACAGCCTTCTCTTGTGGAGCTGGCTTTCGAAGTGACGCGTCAATGCCGAGATG
GCAGCCTTGATGCTGGTGTCCGCTGTCGGCGGCTGCATGGAGGTCGATAATTCAGGAAGTGCGGCTGGAGGTGGCTCCATTCTGTCATAAACTACCGCCG
TAAATTGAGAAGTGAGACCTCGTTTGTGTGATTCAGTTTTGGTGGGACTGCAAGCAATGAGAAGGGCTGTTTGCGTACGTTAACCGTCCGCTGTGTACTG
AAGGCCGGTGTCAGCTCCGTTCTCTCCTTTGGTCTCGTCTAGCTTTGATGCGTGCGCAGAGCCAACACTTTCTTCCCGCATTGTGCTGGTGCTGGCAAAA
CGTGCATGAACACGTTTCTGCAGGCGAGGTCCGCGCTGTCTCAAAGGCAAAGACCGGTCGACGTTCATCAGCGTCGGGCCTTGATGTCGCTCGGCGCCTT
GAAGTTGTTAACTGACTCGCACTGCACAATCAGTCCCGAACCGAGGCGCCTGCATAATCGATGCACCATCTTTCTCTCACGTGATTCCCTGTTGGTCAGT
GAAGGTTATCAGCATCTCATCGCATGGTTCGTTTGGCCAGTCGCGACGCTGCCCGTTGCCGTTGCAGCCGCACTTGCCTCCGTACCTGCTCAAACACGAC
AAACCATTTCGGTGGTGGAACCTTCAACTTGTTAGGTCTCCAAGCAGTAAAAACTCGTGGTCGCCCGACCCTCATG