Description :
From Genome Similarity Track
Location :
Scaffold_301:15690- 19216
Transcript NameFunction/comments
Albla_Nc14116270autophagyrelated protein putative
Albla_Nc14116280conserved hypothetical protein

Sequence
3526 bases(100 bases per row)
CATTTCAATAATGAGCTCTTTCATGAAAGAACATCCTTATGGTACGGTCAAGTGATACAGCTATTAGACGCAATATTCACTGATACTCGTTTTACAGAGA
AGCGTCAAGCAGAGGCACAACGCATCCGATGCAAATATCCTGATAGAATACCGGTACGATATACAAGAATATGGCGCTTGACATTCATTTTCTCACTTGT
ATCATATAGGTAATTTGTGAAAAAGCAGATCGAAGCGATATTCCAGATATTGACAAGAAAAAGTCGTTTCGTGTGCTCTTGTTCAACATATACATTCTCA
CGACTTTTACACTAGGTATTTGGTACCGGCGGATCTAACTGTGGGGCAATTCGTATACGTCATTCGAAAACGGATCAAGTTGAGTCCCGAAAAAGCAATT
TTTATTTTCATCAACAATGTATTGCCTCCCACAGGTATGTCCCTACTCAACACTCATCATGATCCCGCACTAATCCGTATATTTCTAGCTGCATTAATGT
CCAGCATCTATGAGGAGCAGAAAGATGCCGACGGATTTCTTTACATCACATACAGTGGCGAGAATACTTTCGGCACTCTTGCATACTGAGTATCCATTTA
GGGATATCTATGATCGGTATTGAGAATTTGCACCAAAAACATTCATTTTCGAAAATAGTACTTATTCTCTAAAATCAAGAGTAAATGTTTGGAATCCATC
GCCGGCGATCACAACATCCCATTTCTCTGCGTCTTGCTGATGTACATCCAATGCGGAGACATCCGCACATTCGGAAATGACAGAGGCTTTCCAGACGATA
GGATTCATTGCATACACACTCAGACGTTGATCGTACCCAGCAATAAGTAGGACCTGGCCGTTGCTGTATAGTGCTTTGATAGCTGATCCGCTTGCGTGTG
GAATATGTGCGTCATGAGCTGTCGTCCAATAATGCGATTGAGCGCTGAAAGTGATATCGCGAACTCGGACACTTTGATCGTCCCCCGCACTACAGACAGA
TACGACCATCTGATCCATAGAAGCTGCTTCAGTTTGCGGTTGAACGAGAGTGAGCGTATTGGTTCCCATTTCATGCGCCACATAAGAATAACACGGAGAT
AATTGGATATTGCTGGTGATTTGACGCATCTCGGTTGATAGAGTCTCTAGAAGGCTGGAGAAATCCCAGACATGAATCATGCCATCGGTGGATCCGGTGG
CTAACAACGCAATTTTTCTGTTTGCAGATGTGATCTGTAGCGCTGATAGACATAAAATTGGTTTGAGGGAGGCGCTGAATTCCCCGATTTCGGAGAATGA
CTCGTGCGTGAGATCCAATAAAATACATGCGATGACACCTTCCGAGTTTCCAGTGATCACAAGACGATAACGATCGTGTTGTAATGAAAATGACGCCAAT
CCCAAAATGCGATGTTCTTGTACATCAGATTTCTCGCTCGTGCAAATATGACGGAGAATATAAGGATTTCGAGACACCTTCCACGCATTGACCGTTTGTT
TCCCTCCAGCCGTTAGCACAATTGTTTCGTCGTGCAGTGAGAATTTGGAAATGGCGCGAATCGCACTTGTATGTGCGACTCCGATTGCCACACGCCTCCA
TAAATTATCAATTGGCGCACGGACATGCAGCTGAAGCTGATTGTCTTCCGACCCGGTGACCAAGTCTGTGTTACTGTCCAGGAACATTGCGCTTGTAATC
ATTCGACCATGAAACTGATGGTGGAACGAGCATGCATTTAGAGCCATAGAACCTTTCGATGACACACTCTGCAGCTCCAAAGCCGTTCGAGTGTGTTTTT
TCTGTTCTCGGGTACAAAACAAGAGCGTATAGTCCACGAGCGCATTTGAAGTCAATGGTATGTACATGGCATGCGGCCGTCGCCATCCACCGCAATCTAG
ATGAAATAGCCGATACTGCCGAGTGACATTGTATAGGATAGCGTGACTGGCTTGGAAACCGAATACCAGCAATTCTTGTCTCTGATGATTCCAGGAAAAC
TTGGAGATCGTTCCCATTCCTTTGATAGAATGCCGAGTCAGTAGTGATAGGACAAGATCGTCTTTTCGAAAGCACATGAGGAATGTGTTGTAATACCCAT
CATGGCCGCCTGTAAGGATACGGTCGCCGTCAATTGCTGTGATGCAGGATACATACTCGCGACCATGTACGCTTTTAAAAATCGAAGCAGGTTCTATGAG
CTCTTGATCGACGGAATGATGGGTACAGGAAAACGTACAAATCGTTCCATTTCCGTCGCCAGCGATAAGAAATGTGGTGTCCATCTGCTCAACCACTTGA
AGCGAGGAAATTGCAGATTTGCTTGTGTTAATCCCATAGGACTCCAACCTTTTCCAGTGCAATGTTCCTTCGGTTCCTCTCAAAATACGCCATCGTACAA
GCTTGCGATCAACGCTGCTAGTGAAGATTGTGCTCTGATCTGTTTCGGCCGTGTTCGAGTGCCACCAAATTCTGAGTATGCGGGCTTTAACCGCTTTCCA
GCTGGCCACCAGCGCATTATCAGAGATCCCAAAAATGTAGATCCATCCACTAGAATTGCCAAATGCCAGATATCGCTTTTGAGGATCCATACAAGTGCAA
GATACCGATGCAGTGGCGTCCATGTGTACACCATCTTGAAATGGAGACCACAACAATTGACTCTGGGATTTTTCAATGTCAAGGGCGTGAATTTCTCCAT
TATCAGCAACGCAATACCCGCGATCTCTTCCAATCAGCACATCCCGAATCGCAACAGCTCGCTTGGATATCTGCCCACGCTGTGATATTTCACCAAATCG
AAGGTTGATGTTATGCTGTTCCGCTATTGCGAGCGTATGTGATGGATGAAGGTGTTGATACGTATCCCATAGCTTAACAGCTCCATCTCCACCACCTGTA
GCGATCAATCGCTTGTTAGGATGACACGTCACACGCCAAATATGTTTTCCAACATGTCCTTGCAACGTCGCAATGCACTGCCCTTCTTCGACATCCCACA
ATTTACAAATCCCGTCTTCACTGGCCGTAGCAATACCCTGTTGAGTGAAGCAAGCATCCCACAGTCGGCCATGGTGTCCCCATGCCCGAATTTTGCTCTC
GAATATGTGCTGTTCTGTATTGATACTGCAAAGTTGCATGGTACGATCTTCCGACACGGAAATGAATTGCTTACCATCTTCGGACCAGATGATACGAAAT
ACGGCTCCATTGTGCATATCTAAGCGCTGCGTTGGTTGCACGGATATTGCTGATCGATCGTTTTCATCATACGTCCCTGGTAACTTCCAAATAATGATTG
AGCGGGTCACCGTCCCGGTCGCAATGCGCAAGGTATCGAGAGAGCGACCATAAATGCTCATCGAATACAAAATGCCGATCGCGGAGCTCTGAAACGTCAT
AAGCGTCGTTCGTTGATGCGAACTGTAAATATCAACAAAATTGTGTGCGTACCCGATGGCAATTAACGGGAACAAAGTCGTTTCCTCAACTGTCTGAGTA
AGGATTTGCACGCAGAGAATCCAGTC