Description :
From Genome Similarity Track
Location :
Scaffold_1489:1569- 3813
Sequence
2244 bases(100 bases per row)
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAACCGAGCTAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCTTCCGACGTAGAAC
GTTGGATGGAGGCGCATACTAGATGGTATGTCCAGTGTGTAGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGTCCGATGAAGCGCGGAGCGAACTTGC
TCGCCCCGAAGTCGGAAACGGCATGTTTAGGCAGGTTTTGAGTAGCTAACAAGACTAATGAACCCTTCTCGAATTCATTAGTGTTGCCCCTGCCAACATT
GTCTGCGTTCAACTTCTGTCGGTCGACAGAAGCTGCAATAGCGTCCTGGACAAACCGAATGACGGCTTGTCTGCGCTGTACGAAGTGAATTGCGTCCGAG
CTGAACTCGTTCAGCTCGCTTCCAGCAGTAGGCCCTGCCTCTGCGTTGGTCTTCGTGGTGTTTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTTTTGC
TCTTGTCGGCGTCTGTGCCCTGCACAAACGCGCGGTTCTCGGCTTTGCTTTGTGTCGTTGCGGCTGACACTGTACAAGTGTTAGAGGCATTCTGCGGCTG
CTGTGTTGGAGTCGTAGATCCCCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGACGCGTGGGTGCCTGATGGCATTCACGTAGAACGGT
GTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCA
CGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGCCTCCCAAGAAGTGTAAACACTTC
TTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGTATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTC
TGTTTCGCAGTCACTTCAGCGGGTACTGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGG
GAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACG
TTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGT