Description :
From Genome Similarity Track
Location :
Scaffold_74:156880- 181327
Transcript NameFunction/comments
Aphas_H257_16499Hypothetical protein
Aphas_H257_16500Hypothetical protein
Aphas_H257_16501Hypothetical protein
Aphas_H257_16502PREDICTED: uncharacterized protein LOC100900680
Aphas_H257_16503unnamed protein product
Aphas_H257_16504Hypothetical protein

Sequence
24447 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTTTAACAAATTGAACGCAGCCACGATTCCGGCTCAGACGCCGAATCCTCGCAAGGACGTTATTATCGACG
GCATGGGTCCACCATTTTCTCCACCATCGACCTTCGCGATGGCTTTTACCAGATATTGATGGGTCTATGTGACGTCCCGAAAACGGCGGTTTCTACGCCG
AGTGGCATGTTAAATGGGAGTGGCTGGTCATGCCACAGGGTCTATCCAACGCCCCGGCGACGTTCAATCGTATGGTTACCGCGAAGTTCCGCGCGTTTCG
CGACTTCGCACCGTCGTACTTCGACGACATTTACGTTCACAGTTGCGCCTCCTCCGCACAATCTGATCTTGACGTTCACCGCGGCCACCTCCGCAAGGTG
ATTGATGTCCTCCGTGCCAACGGACTCTATGCCAACCTCGCCAAATGTATGTTTGGCGTTGACGAAATCCCGGTCCTGGGAGATTTAGTGGGGGTGAACG
GATGTCGCGCTGATCCCGAAAAGATCAAGGCCATTTCGGAGTGGCCTATTCCCTCCTCCGTCAAGGATCTTCGTCGCTGGCTGGGTCTTGCGACGTACCT
GCACAAATATTCGCAAAACTTTGCGGACATCGCTCAGCCGTAGTTTCGGCTTCTCCTCAAGGACGCCCCTTGGGTTTGGGACTCCACTTGTCAGGAGGCT
TTCGATGGCCTCAAAACTAACCTTCAACACGCCCCGATCTTGGCGCTCCCGGACTTTGACAAACCTTTCTGCATCGTTTGCGACGCCTCGCAGTTTGCAA
TTGGCTGCTTCCTGATGCAGCTCGACGCCTCCGGTCGCCCTCGCCCGGTTTCCTACCAAAGCCGCCAACTTCACGCGGCTGAGCGGGCATACCCAGTCCA
CGACTTGGAATTTCTCGCTATGAAGTACGCCCTAACCAAGTTCCGTATCTATCTCCTCGGTGGTAAACCCTTCGTGGTTTACACCGATCATGCGTCCTTA
CGCACGGCGACAAAAACACTACACCTTTCGCAGCGCATGGCGCGCTGGATTTCATTCTTCTCCGAATTCACATTTTCGGTTCAGTACAAACCCGGGAAAG
ACAACATCCTGGCCGACGCCCTATCTCGGCTCTACGATCGGTCTCTTAACGTCGGGTCTTCACGATCGAATTCGTGCGGCGTACCCCTTTGACGCTGAAT
GCTCGTCGCGCCTGGCGGCGCTCACCGACCCCGTTTCCCCAAACCCCGCCGTGCTTCGTCGGCCTTACACCGCTTCGCCCTCGCCGATGGGCTTTTGATG
TTTCAACCCACCGCGGACTCACCGCCGCGCATTGTTGTGTGTCCAGCGACGCGCAGCTGCGCCTCACTCTCCTTCGATCCTACCATGACTCCCCCAGTGG
CGGCCATTTCGGCCATTTCGGCCCCGACAAAATGCACGCGGTCCTGGCGCGTTCATACTGGTGGCCCCGCATGTACAAATCCGTCGTGCGCTACGTCGCT
CATTGCGACGCTTGACAGCGCACTAAGATCACCGCCTCCTCTCGGGCTCCGCTACAACTTCTGCCTACTGTATTCCCGACGAACTTTGGTCGTCCGTCAG
CATGGATTTCATGTTTGGCCTGCCACGCGACGCCCGCGGCAACACCGGCATTATGGTTTGTGTCGACCGAGCATCGAAGTACGTTATTGCCGTCCCCGTC
CGGGACACGCTGAGCGGCGCGGATGCCGCTCGCCTCTTTTTCGACCACGTTTTCTGTCGTTTCGGCCTGCCTCGCTCCATCGTTTCGGACCGCGACCCGC
GACCCGCGGTTCACGGCGAAGTATTGGTCCACCCTATTCGCCCTATGCGACACCTCGCTCGATATGTCGACTTCGGATCACTCCGAGTCCGACGGCCAAA
CGGAACGCGCCAACTGCGTTCTCGAAGATATCCTCCGGAGCTACTCCGTTTCTACCGGTTCCTCGTGGGCTGTCACGTTACAGCACGCAGTTTTCGCTTA
CAACGCCTCGGTTCAGGCGTCCACTGGCTTTTCGCCGCATTATGCGGTCCATCTCCAACACCCCCGCCTCCCTCCTGTGCTCGAGGGTTCGATCTCCAGG
GGGGGGTGGAGTCACTTCGCGGCTTCGTTCTGCAGGCGTACTTTCCAATGCCCCCAACCGCACTCTCGAAACAATTCAGAGTTTCCTCTCCCGTCGCGTC
TCTGTTATGCAACAGATCCATGACAGCATCGCTGCCGCTCAGCAGCGCCAATCAACTCAAGCCAACAAACATGGCCGCTCTAACCTCGCGTCTTTCGCCG
TGGGCGAACAAGTTGTCCTCCACAAGTCGGCGGCGCCTGCCCATGCATTCCGCGCACGTGCGGTTGGAATGTGTTCCAACGTCAAGCTGCGCAGTGCTTG
GCACGGCCCCTTTACAGTTCTTCGCGTGGTCAGTCCCACCAACTACAAGCTGGACCTGCCCACCTCATGGCAGATCCATCCAACATTCTATGTGAGTAAA
CTCAAACGATATTTACCGTTATTATCTACACCTACGACCGATGAAGTGACAGCAACCGATCCTCTGGATCCCACGGCGGCTCTTCCTCTTCCACCGCCTC
CGAGATCTCCTCCTCCCCCGACACCCCAGCCGTCGCCGCCCTCGACATCGGCACCACCACTTGTTGCGGCGCCGCAACCGCCCGCGCCCCAGCCCGATAA
TCCGCGACCGCTTGTCGCTCCGCCGCTGTCAACTGCCCATCCCGTTGATGTCCCGACGGCGGATTGTACCCCGCGAACGCGGATTCATCGGCCGCGCCGC
CGACAATCGCGCTGCCATCTGCGCATCTTCGCGCGCCCACGCCGAGGAACTCGCCGTCGGCGAAGCCCATACGCTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGCAACTGCCCATGCCTCCCGCTGCCTTGCCCGACCAGCGTCCACACAAACGCTGCAATGTACTCCAGCAATGTTACATCGTTGCAG
AGTTCGATCCGCCCCACGTCAACAGTCCAGCGCTCCAGGCGCTCCCGTTCATGCAATTCGCGCATGGCGCCCTTGAACTCATCGAACCGGTGAAAACTCA
CCCTCGCAAGCTGCATGCATTCCATGGCAAGCAGCATCCACAACACCCGCAACTCAAACGATTGGGCGCTTGCAAACAAGCGCAGGTACCGTTCCACGCC
GGCCGCATTGGCCGTCTGGTATCCCCAGTCGTCGCGGGTTTCGTCGAACTCGCCCACTACTGTCAATCGGCGCGTAACATCGCGCACATACCCCAAGTCC
ACGCCACCCCAACCGGCAGGCGTGAAGATCCGAGAGCGATCCCAGTGGAACCCCAGCTCACGTTCAAACACTTCGTCTCGGGTGAGGCCGGTTCGCTCCG
GCCCACCAAGTTCGGCCTCCACTTTGGCCTCCGTCTTTACGGCGGTTCTCACGCCGCTCGCCTTACCTTCTTTTCACCAAACGCCTGTAGCGTTGGGATG
TCCCCCATCGCCTGAAGGTGTTCCCAGTCACACCTTCGCTGGTCACCTTCCTCGCTGCTTCCGCAGCCTCCTTGGCTGCTTCGTCCGCCGCCTTCGCCGC
AGCCGCTGCGATCACTTTGGCCTCTTCACTTTGGCCTCTTCGGCGCGCCTTGCCTTCGCCTTCACCACTTCGACTGCTCTTGCCTTCTTGGCGGCCTCCT
CCCGTGCCAAGTGCTGCACCAGCAGCTTTTGCACACCTTCGGCGCCCACTGTTTTGCATGGCGCTCTTCACCAAGTCGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGAGATCAGCAGTA
GACAAGACCCCAGTCACGGCCTCTGGAGCCCCAGCAGGCACAACTACCGTTCCCCGGTAGTTGCGACTTTGACTATCGTAATTCTGGATGGTGGTTGGTG
GGGTGGTGGTGGTACTGACTAGCAGTCAAGTGATTACCTACCACCTAAACCACTACCACCCCACCCCTACGCTCCAGATTAATGCCCAAAAACCCTGCTA
ACATTACCCCAGTGACTACGATTGCTGCACATGTGACCACCCCATCACTCCATTGTACAGTACATGCAGTACATCATCACGACTAGCCATGTCACATCGA
CTCTGTGTTTCCTCTAAATCGACCACCAACGGCCACCAAGTTTTGACACTATTTTGTTCGGTACTTGGTGGCATGGTGATGACATGCGCAGCGCTTGTGA
CCACCGGCACTGCGCATCTCACCACCACTCCATCAAATACACTCTAAGTTGTGTGAAAACGGATTACGATGTGTGGCAGTGATAGTTGATTGTACCATTT
GATGCTGGGGTCCCATCGGCGTGCAAGTGTCGCGGGGTTTCACGACAAATCGAATGGGTAGGTGCGGCGTAGGCAAGCGTGTAAAACACCAAACGCGTAG
TTCAGGGCAAAATGTAAAGTCGAGTTAGTTGGTTTAGCTTCAAAGAAAAGAGTATGACTAATGGATAATCCAGGTCCAGGACGTCCGGAGTCTGGTCCGG
GAGCCCTATAATAGAGCTCAGGGTCTTGTCCGTGGTCGTCCTGGGTTCAGACCCCCCAGGGACTAAACAAGTTCGGCAAGCACCCCAAGGCTAAGGACCG
AGCCCGTAGCTCGCTCGGCTTAAGTCCGAGCTACGGCGAGGACCAGTTGGATCGTAGCCAGCCGTCACACACAAAGCAAAATCCGCCAAACCCAATGGAG
AAAGCTTCCGCCGGGCATACGCCTCCCCACACGGCACGCTCATCCGGTGCAGGTTTGGCCGCACCGGCCGCTCGGATGAGCCACATAGTAACACCGACCT
TTGCAGCGCACATCGATCAAGTCGCCGCCCAAATACAGTTGTTGCTCGAGCTCCCGTCGCCAACCCCACCGACCCATGTGGACCCGGACCCCAACCCGGA
CCTTGTTGACCAGTCCGGAGCTCGGGGAGCATCGATCGGAACGTCATCCGCAGGGCATAGTCCGGCGTCCAACCTCGAATACACCTTCCGGGGGCTGTTT
GAAGCGTTGTCCGTGTCGGCCGTCAGCAATCAGGCCCTCCTGGACCGCCTGGACCGGACCGTGCGGATCGAGGCGGCACTCCGAGTCGTCCTGGCCAGAC
TCCTACCGAACGGACCACACACTATGCCGGCGGCCCTCCGGCGAATAAATGAGGAGGTCGAAAGCCTTGGAGATGCACTGAAACAGGCCCGAGAGGAACG
GGAGGCCGAAATGGCGCTCCGGGAGAAGGCTGAACAGGAACGGGACCAGGCCAACACCGAGCGCGACCAGCTGGAAGAGTGCGTCCGTGGACTCCGGACA
GAACTCCGTACCTGTAAACGTAGAGCTGTCAATTTGAGCACCTATCTGGAGCAAGCACTCGCCGAAAAAGAACGAATCTCCGATGATCTGGGATTCACCC
AACAACGTCTGAGCGTCCAACTGGCCGCTACCATGTCCGAAAAACGCCGGGTCTGGAAGTTACAGACAGCGGTGGTCCATGGAGAAGGCGAAGAGGTAGT
GACACGACGGAACGCCAGGACTACGCCCCCCCTCAGGCCCTGGAGGGAAGGTGCAGCCTCGCTAGCCTTTTTGAATCCGAAGAGGGCCGATACCGAGATC
GACAACCGACGTCAGGCACAGGAGACCGAGACTGAGGCACTAGCCGGGAAGAATCAGGCAGCCTCCTCTGCTCTTGCTCGGGTCGGAACGCAGGAGCGTT
GTATGGCTCCCGTAGCCCCGGTGGCAGCTCCGGCCGCTAGAGTGCAAGCCGCACAGCCTCCGGAGGTCGTGGCTTTGTTGGGCAAAGTCCAGGGACTCAG
GACTCGGCTTCGCGAAGCTCAGGATGAGGCGAAAAAGTACAAAGACTTGGCGACTCGGGTAGAAAACGCCATTCAAGCCCAGTTATCCTCAATGGCTGAT
CAAGTACGCGAGCTGGACCGACAACAGCGGTCGCACGAGGAGGAAGTCGCAGAGGTTGAAGAAAGGTACCGGGTCGAAGTAGCAGGCCACCGAGAGGCGT
CCAGGGCTCTGGCGACCGCCACGCAGCGATTCCCGGACGTCGTCCCCGCTTTCTGGGACTGGGTCAGTGCGCACTTCCGCGTGACGAGCGGGCCGGTGTT
TGACCGGCTTCTAGAGGCGTGGGTCCGGGACGACCCAGCCCTCTTCGAAGACAACTGTGAGAACCTTTCCATATTCGCCTTCCCGACGCGACAACCCCCG
TCCACACGAGCTCGGGGCCGAATCCTCGGGGTGTCGTATGACAATTGGTCCGCGGTCCTGGCCCGGGACCAAAGGTCACATAGCCTGGCTGTCCCGACCC
TTCCGACCCCGACCTCGCTATCCGGACCGGCGTCATACCAGGGGTCTCCCGGGCCTACCCGCACGATGACTTTGGTCCCAACAAAATCGGGGTCGTCCAT
GACCCCCGGGACTACCGGTACAGTATCCGCGGACGCGGCTTCGAGCCTCAGCTCAACGTCGGGGGCTTCGGAGGGAGCCTCAAGGGCGGTCCAGACCACA
AGGGCCTCGGGTATGGCCTCTCCTGGCCCCTGAAGCACCTCGAGCAGCGTCCCAACAAATCTTCCAGCTGCCCAGATGTCGACTCCGTCTTCGAAACGTC
CCTCTCCCGGAGCGTCGACGCAGTTGACGAAAAAGGCCCGACGCTCCGACCCTGATGCCGCGGGACCCCTCGGTGCCTCCTTACCACCCCCGGTCGATTC
GGCGTATGCCGCCGTGGTCGCGAGGAGCCCCTGGGTGCGCTACTCGACGACCCAGGTGTCGTTCGTTCCGCTTTCGTGGCATCAGCTCCCAGAATGGCGA
GAATTGGACCGGTCCCTTCGTTTTGGCAGAAGTACGCACACTCGATTTGGAACCGTTCGTTTATGACGTCGTCCGGCGCGGCCGAACGCGAGATCGAGGC
TCTCATGGGACCTTTGTTGGGGATTGACGGGAGCCTGTTCCGCGTAGTCCAGGCGTACGGGGTCCAACTGCTGCGCTTTCTGTGCTACCCGCACTCCTAC
TGGCCGGAATTCCTTCAAGAGAGAGTGTCCTTGCGAAATCTAATCACCTTGCACGGCGGTCAGGCGGTGGCCGATTACGTCCAGACTCAAGGTCCTGAGT
GGTGGCCAGTCGTGTCTTTCTTGGGTCGTTCGAAACCATTCGCTCCCTCGTTCATGTCCGTCCTGTCCTGGTTGCATGGCCGGACATTGCGCGCTAAACT
CTTGAACCCGGCGGTCTGTACTCGCGCGGCCAACTCGTCTGCCTTCGGATGGATGATCCAGGAGGCCATCTCGGCTCGGGACGCAGGAAATGTCGGCGGG
GTGTATCCGTTCATCGTGGGCTCGCATTCGCATCCCCCAGTCGGTTCTGAGTGGGCACGCGGTCTGAGGCCTCCCCAGGGCCTGACTCCTGGCTCTCCCG
ATCCGCCGCTTCCCGTTCGTCAGGCTCCGCTAGGGATTCCCACTTCGACTGCGCCCGCTTCGGCCGCGAATCCCGTCGTCTTGGATGATTCCTCCGAAGG
CTCCCGTACCGATGCCGACTAAGTCTCCCAATCGACATATAATTGTTTCTTCTTTTTTTTTGTAAATGCATTCCATATAACGTGCAATGTCGTTTGTCCC
GGGGATTTCCCCCGGGCCCGGCGACTCCCGGGTGGTCGACTAGTATTTCCGGACTTCGCCCTCCATGTCCAACTCGGCGAGTCGGGGGCTTCGGCGCAGT
ACCGGGAGTCCCTGCTGTGTCCGTGACTCATTCTCGTATTCCGTGATAAATGAATTGTAATCGACCAGGCGCGATCGCCGTGTCCAGTGGGTCGTATCGT
CAGCGTGTTGCACCAAGTACTCCACTTCCCGGGCTTCGTCGTGTCGATTGTCCAGTATGCGCAGGATCGGGGAATGAGAGTTCGCGTACGCCACGTCTCC
ATCAGGGAAGTCGACTCGTTCCACAAAGCTCGATCGGGGCAGTAAGTCGTCTTCCAGGACCGTGTCATCACTTGCGGTCCCGCGTACTGTTCCGGGACCT
CGTCATTGAAGGGTCGGGTCCAGTATCCGTGAAATGCTTTCAGGCGATCGACGTTGATGGGCACTATCCGATTCGGGTGGGACGGCAGGTAGATTCGGTA
CGTGTTGTCGCCCTGTTTGGAGTACGGACCGTGCCAATGGTAAGCCAGCTTCTGGACCCGGACGTCCTCAGGGTTCCGGGACTTATGAAAGTGTTGGTAT
ACCCATACAGAGTCGGTGGGACTGAACTCCACTTTTCTCTGTCGATCCCGGTACGCGGCATCCCGGTTCTGGCCCCGGAGCAGCTGGCCTTCAATCAACT
TCCGAGTCGCCATGAACCAGGCACTCTGCTTCCGACGCCACTGCGGCAACTCGTCCGACTTCCATAACGGCTCCTGGTTGGAAAATGCCAAGTGCAGAGG
CTGGACCGGGTCCCTTCCGTACATGCAGAAGAACGGAGTGTCTCCCAGAGTCTCCTGATGGGCGGTCCGGTACGCCCACATGAGTCGGGGAAGGTAGGTG
TCCCAATCCGTATGGGCCGCATTGACGTACATTTTGAGCATCATGGCGAGGGTAGAATTGAACCGTTCGACCAGCCCCTGACCTTGAGGGTGCCCCGGAG
CGTTGGCGACCTTGTCGATTCCCAAAGTCTGGTACATAGTTTCAGCTAACTTGGATACGAAATTTGACCCCCGGTCTGAGAGCAGTTTGTCCGGGACACC
GTACCGGCTGAGAAAGGAGGATGTCTTCAAGTCCGGGACTGGAATAGCCTCGGCCCACCTCGTGAGTAGTCCATAAAGACCAGGATGAACTTGTTGCCTC
CCGAGTCGAGGGCAATGGCCCCAGGGCATCAACGACAACGAAACTGAAGGGGCCCCGGAGATCGTATACAGGCATCCTTTGCAATCGCCCCTGTCTCCAG
GGCCGAGTACCCTTCGCCGCACTGCAGTGTACGCAGCACCGACAGTATTCAGCCACGTCCTCCCTCCACCGGTGCCAGTACGCGATTCGGCGTACTCGTT
CCAAGGTTATTTCCCTACCAAAATGGCCAGCTAACGGGGAGTCATGGCATAGAGACAGAACGTCTGTGGTCATAGACACGGGGATCACCGGAACCAGGTT
CATGTGCGGGTTTCGGAGCGGGGATTTTAACACAACACGCCGGTACAATACGCCGTCCTTCACAGAGTAATGTTCTTAGGTTCGGGAGACCAGTCGCATC
AACCAAAGGTCCAGCGGGAGCGCGTTCTCTTCCAGATACGCTTTCATGGCCGTCCCAAATGGGTCCCTTGCCTGCTCACGCCGGAGTAACGCGTCCGGGA
GCGTGTAGGTATCGTCTTGATAAGGTTGTAGTTCACCGGTTGAGGACCCGGAGGGTCCGGGTCTGGTCTCCCGTTCCTTGGGTCGTCCTTCCTTGGGAGT
TTCTTTGCCAGGAGGGTAGGGGGCCGGATCCTCAGCCGCGGTCGCCCGGGACTGGCTCCGTGTTACGGCTCCGACCACTCCTTTAGCGATTGCACACACT
CGTGGCCCACCCGTAGGTAACGGGAGAGTTTGGAATTCTTCCGCTTCCGGGTCCCATCGTAGAGCGACGGCTCCGGGGCCTCCCTTCATGTCCTCCTGCG
TTTCGAGGGGTAGTCGGGACAAGCCATCCGCACACCCCATGAGGGTCCCGGGCCGGTGGATCACCGTGAAGTCCAGGCTTTGGAGGTGTACTGCCCACCG
GGCCAACTTCCCGTTCCCGGACTTCGATCCGGTCTTGTATAGCCAAACCAATGCTGCATGGTCCATATACACCGTGAAATGTCGCCTATCGATGTAAGGC
CGAAACTTGCCAGTGGCCCATACCAATCCATAGCATTCGATCTCAGAGACTCCATCTTTCTTGGAGATCCATTTCCGCTGGGTCGCATCTAGCGCTTGGC
TCGCGTAGGCTATTACTCGGTGTCTCCCTCACTGTTCCTGTATCAAGACTGCCCCTAGGGCGATTGGACAGGCGTCCACCAGGATCGTGAACGGGAGATC
AAAGTCCGGGTACGCCAAAATCGGAGGGCTGGCCAGCTTTCTTTTTAAGGTATCCAGGGCCTGTTGACATTCGGGGGACCACTCGAAGGTATCGGACACC
TTGAGGTGTTCCAGGGGTCGGGAGATGGTAGCGTATCCCTTTATGAATCTTCGGAAGTACCCTGCCAGCCCCAGGAAGGACCGCACCTGAGCCACATTTC
GCAGGGGTTTGATTCTCAGGACGGCCTTGACCTTCTCTGGGTTCGGAAGGATTCCTCCCGGAGTTATCGTATGCCCCAGGAAAGCGACCCTGTCCCGTCC
CCACTGGCACTTGGACATCTTCAGTTTGAATCCGGCGTCCTGGAGGCAGGTCAGGACCTGTTGAATCCGGACTAGGTGAGTCCCGAATTCTTCGCTGAAG
ATGATTACGTCGTCCAGGTAGACCAGACATATACGCCACAGGTAGTCTTGGAGCACTCCCTCCATCAAGCGCTCAAATTGCGGGACCGCGTTGCACAGTC
CAAACGGCATCACCAGCCATTCGTACAGGCCAAATTTGCACGTGAAGGCCGTCTTCTGGATACTATCCTCGGCCATGCTGACATTCCAGTACCCCGAGGC
CACATCCATCGTTGTAAAGTACTTGCATTTTCCGAGGACGTTCAGGAGGTCGTCCACTCGGGGCATGGGGTAGCAGTCTTTGACAGTCACATCGTTGAGC
TTCCGGTAGTCGATGCAGAAACGTATAGAGCCGTCGGGTTTCTAATCATCAACACCGGACTCGCCCAGGGGATGGAGGACTTCCGGATCAATCCCAGCTC
CAGGTACTGACGAATCTCGGCTTCCATGATCTCTCCTTCCTTTTGGGTAACCCGGAAGGGTGCCGACTTAATGGGTCTGGCATCCGCCGTATTGATATGG
CACTTCACCAGGTCTGTCTGTCCCGGAGCCTTCGACGTGGTCACGAACAACACAAGAGTAGTTTCCGAAGCAGTTATTTCTGTGGCGGGCTGAGACTGGA
GTCCTTCCAGTCGATCGGGACCTCGTCCTTGCTCTTCTGGAGTGCTGCACATACTCCTCCCGGGTGTGTGTCGCCCTTCTGACATTTCATTTGTCATTTC
CGCGTCGCCCCTTCCCCCTTCCTGAAAGCTCGCACTCCGGGGCGTGTGCTGGTCCGTGGCTTCCGCCGTCTCAAGGTCTTGTATTGAGGTCGGTACCAGG
GTAGCCACGGCCATAACATCGGCAGGTCGGATCTCGACAACCGAATCGGTCGGGTTCCGGAGTTGGATCCAGACACCGTTGGCCCGACTACGGTTGAGCG
ATCGAGCGACCTGTAGCGGGAATGCACCTTGCAGTTGTTCGACGAGGACCATGTGTCCTTCCGGGACTGGATCGGAGAGCAAACAACAGATCATGTGACG
AGAGCGGCTCCGTAGGCGAACGGTTTCGATGCCGTCAGGGTAAGGTGGGGCGGTCCTCTACCCGGGTCTGCCCCCGTTGTAGGGGCGCACCTGGGGTGTT
CTCGTCCTTCCGGCGGAGATGCGCTACAGTTCGGTCCTGTCTGGGGAGGTCATGCTCTCCCGGGGTGATAAACGGGAGGGTCACTCGGTTGCCTTCGAAA
CATACTTGGTCCCGTCCGAGGTCAACGAGAGCATGCAACGTCCGGAGGAGATTGACTCCCAAGATGCACGGGGTGACTGAGTCTTCCAGAACCCAGACCG
GGAACGTTGTAGAAATACCAGCCAAGGTAACGCTGCAGTGTCGAAACCCCAGAGTCGAAATGCCGGCGTTCGCAGCTGAAACTAGACCGTACGACGGGGT
ACGGAGAGGAGGGCGGCCCAGGAGCATCCAAAATTCCTGACTAATGACCGTAACCAAGGCGCCCGTGTCTACTAAAGCTTGTGTGATATGGCCATCGATG
GTGGCCAGAACAAGTGGTGCCAGAGATCCGGTCATGACGCCACACAACGGATATGGATCGCGGGTCCGGGAGTGAAGGAGGGCCGTGAATCCGGACTCGT
CAAGGCCCTGGAACGGCCAATCCATGCACCGAATAGTCTCCCGTACCTCCAAACCCGCTACTTCAAGACGTGTAGAGTCCTCCTGGACACTCGGGTCGTG
TCGCCTGTCCGGAGCCTCGGATTCGTGCAGGAGTGGGGGGATGTCTGGGTCGATCACGGCACTCCCAGGTCGAGTCCTTCGGTTGCGGACTCGAGGTAAC
GTCGCCGAGAGGTCAGAGTTCGACGACGTACCCTCCAGATGTGTGAGTGCAGTCGGGTAGCTTCTAAGTCCCGGAGGGGTAGCGTCAGTTGTACCCCGAT
GTCTGGTAGATAGAACATAACCGCACCCTCCATCGAGACCCGTTTCTTTAGGCGAGCCCGGCCATCCGCAGAGGAGGCGAGGAGTCCGATAGCCGCCAGG
ACTCCCGGGATGGTCCCCTGGAGGTCTGGGTAAGGGCCAATACCAGCAAGCTCTGCCGCTCCAATACCGTTCCGGAACATCGGAGACCACCGAGTGTCAG
CCACCATGGCCACTCGTTCCTGCTCGAAGTTTCGATTTCCAGTGCGGGCCTCTTCGCACGTGTTAAGGGTTGTCGAGAACCAGTCCAACCACCTTTCCGG
GTCGTCGATAACTACCGGGGAGTCGAATAGTATACTATCGGCCTCCGTAAGCGGTCGTTTGAGCTCCGTAGTCACCACACGGACGATGTTGGCATGGGTT
ACGTCCTTCGTTGTGAGCGAAGCGCCTTCAATTGTAGCTCCAGATCCGCGGGCGTGAGCGGGTAGAGACGTTCTTCGATATCCACATGTCGAGAGTCGGG
AAGTCCGGTCATATCGCCCCGGGAGATCGCCTCAATCTGGGCCGCAGTGAATACCGGGGTGATATCCGAGTCCGGACGAAGGTCTCCCTGTTTCGAATAC
CCAGTCCGGGTGTTCCCGACGGTTACAGCACTGATATTCCCGCCCCCCGAACACGACATAACCGGGTCCGGACACCTAGGACCGGGTTCGTCGAGTCTCG
AGATGGGTCTCCTGGCTCCCGAGCGTTGTCTGTCTCTTCCGGGAAGGTGGCCAATGTGCCCCGGACCCGAGGTTGGGTCCGGGATAGGACGGAGGCGGCA
CCCCGAGGTGCCAGAAAATCTCCGTCAGGCAACGCACTAGCGTCGCGAGTGTTCGGTTCAGTTTGTCGACACGAACTTTCTTCTTTTGAGGGTTCTGCAT
ACATGCCCTTCTCTTCCTTGTCTTCGCTCCCGACCGTTTGTCGACGCGAGTCATCCCCGGCGCTGGGTCCTGTGTATACACCCGTGGTCCCGGAGGTCTC
TCCATTAGTCTTGATGCTCTTCTCTTCTTTTGAGGGTTCTGCATACATGCCCTTCTCTTCCTTGTCTTCGCTCCCGTCCGTTTGTCGACGCGAGTCATCC
CCGGCGCTGGGTCCTGTGTATACACCCGTGGTCCCGGAGGTCTCTCCAATTGTCTTGTTTCTTCCAGGCGCCTCGTCGCCCCCTCTTGCTACGTCCGTCT
GCTGCTGTAAGGTCGCTTTCGCTCCCGGGGCTCCAATCGTTTCACCTTCTCCTGCGCTCACGGTGCTGTCTTCCGGGAGCGGCACGGGGCGCGGTTGCGC
ACTCGGCCCGTGCCTCTTATCTGAGGGAGGTAGCATCCTGGCTTCTGTCTGTAGCCTGTCTTCAGGGCGCTCCTGTATCCTGCCCTCTTCTTGCATGTCC
TTGTACGCAGAGCCCGGGATTCCCTTCGTTTGCGGGGGTCGGCTCGCCATGCCATTCTTCGTATCGTCGCCCAGCCCTGGAGCATTCCAGGGTTCGATTG
TCGTCGAGTCCCGTACCACCCCGGGGGAGGTATCTTCCATCTTGTTTGAGTCCTGGGATCCTTCCTCATCCTCCGGAGAGGGCGAGGATATCCCAGGGCT
ACGTGTACTTTGTTTGTTATCATCTTCGGAGGTCATTTGTAATCTCGCGGTCAGTGCCACGCCACATCCGGCGGCTTGGTTCAGACCGCCGAGTCCTCAT
TGTTTATCGGGGTCGGGGTTGCCTTCCATGGATATCTTGTTGTCGGACATATACCAGGATTGCAGAGCAGCCACGACGTGGGTCGGCATAGAGCTCTGCT
TGGACGCGTTTACCGGAAACCCCAGCTCAAATGGCCCATCTTCCCACAGGTGTAACAGGTTGCATTTCCTCCTCGTCCTCCGGGTCCTGATCGTCCTTCG
GGTCCCGTTCGGGTTTGTCCCAGACCCCGACCTCCGTTGTCCCGGGACAGGCTGCACTCCGATAGTCCGTGGCCTTTGGAGCGGCACCGAGTACAGAACC
ACGACAACCGAGGACACTGTTCACGAGAGTAGCCCCGCATGGTACACCTCCCGCAAATGACCTCACCCGACTAGTTTCATCGTCCGGATCCATGCAGATT
CGGGGCAGTACCGGGTTGTTTCCTGCCGGGTTGTCCGTAGAGATCATGGCGACGACATCTTGGATGGAGGAAAACTGGTCGTTGTTAGATGTAGTCAAGC
TCGTCATGTCCCATTGAAGTCGTGAGATGGAGGCCTGGAGCTCCTGGAGATTTCCATGGGGCGTCGAAGAGGATTGGGTCCGGGACGTGTTCCGAGTGGA
CCTGGTCGGCGTCGACGGAGCCACTGGTGTCGTCCGGGGGACCGATCGGGAACCATCCGTTCATCTGTCGATGTCCACATCTCGCTCAATCAGGTAGTCC
AGGCTGATTTCGATAGTCTCAGGTCGAACATAGGCTCCCCGGAGGCACGCGGCCACTTCCGCATCGCTACATCCATTGATCATCATAACCACGGCCCTAT
TGGCCTGCAATCCAGCCTCCCGGGAGGCGTCCGCGATCCGCCACGCATAATCCCGGACGGTTTCCGTAGACTTTCGGTGGGAGTTGTCAGTAATCTCGGC
CATCTTTCGACTCAGTGTCTTCTGAATGAACTCCTTCCAGAAAGCCTCCCGAGCCTCCACCCAGGAGACGGGTTCGCTGTCACGGCACCGTCGAGCCCAC
CAGTCCTGGACGGAAAGTACCCCACAGGATGTCAGGCGGTCATCGAAGATTCGAACGACCTGGGTATCGTTGAGCCCGTACTCCTTCTGGATGGTATCAA
ACTTCGCCAGAAAATGTTCCAAAGGGATGGTCCGGTCAACACTATCGAACTTGGGCGCGTACTTCCAAGCATCGGACATAGCCTGACGGGAAGCCGAACG
GTGAGTGGGGCTGTCCGGGACCAGTGCCGTCTCCCCCGGGGCCGCCTCCCGGAGGGCCAGGAGAACCACCGTAGTACCCTCCAGATCCTCCACCACCAGG
AGGTCCCGGAGGGCCACCTCGGCCACCAAAGGGTCCACCATAATCACCCCCATTCGGTCCACTTCCAGGAGGTGCGGGAGGATTCGTTCGACCTGATTAA
CCACCCCCGTAGCTGCCCCGGGGCTGTAAACCTCCACCCTTGGGTTCCGGACCATAGGAGGCCGGAGGGGCATACCCCGACCTGGTTGCACGAGGGGATG
ACTGCGTGTACCCTGCTCCGAGCTGCTGGCCATAAGCCCCCGAGGACGGGTACGAGTCGGCATCGCGGTTGGGTCGTGACATGGGAGCCGACGTCGGCAC
AAACGGTAGCGGCGTGGTGTTCCGGACTGTAAACTTTGGTGGCATCCGGAGCGAAGTTGATTCCGTCAGCACCTCAGTCTGCTGCATAAAACAGGTTTGG
TCGAAGGCTCGGCGAGGCGTAGACGTGTTTGAGCGGGTGGCCGGGAGCAAGGGCGCCGTAGTAAAAGAAATATGCGTGATCCCGCCGCTTCCTTTAGACG
GAGACCCCATCCGGGACAGAGTCGGGATCCCATATGTCGCGTACGGGGCATTGTTCATTTTCTGAGGCGTCCTTTGTTCAGGTCTCATAAAATTATGCAT
ATTCTAAAAATAGCTCTGCAATTGCATAAAGAAAGGTCAACTGCGTGCATAAACTAAGACATTTTTTTTACACTCATTAGTCTTTACTGACTCAAACGAG
CCCAATGCCGCCGCGCACCACTCCATTCCAGTCCAAGCACTGTCTGGAGTTCGGCCTCGAGATCGTCTCCAGGGACCAGCACGGCAACCCGATGGTGCGG
TGCAACTTCTGCACTTTTGAGGGCCGCGACAAGGTGAAGATCACGGAGGGAGGAACCCGGAAGCGCAAAAGTCGCGTCGACGTCAAGTACTTCACCAAGC
CGTTCACGCCCTTAAACTACCGAAGTCACCTGAACGGTCAGCACAAGGAATCGTGGGACGCATACCAGCAGATGTCGACTTCAGCGAAGAAAGAATACTT
CAACGACAAGATTAGCAGCACTAACACGCTTCACGTCCATATGGACTTGACCAGCGACTCAATCGAGTACACGATCAAGGCGCCCATCGTTGATACGATC
ATCGGAGGGCTGTTCTTCAACGCGGAGGCTATCCAGGAGGAGGACTGCGACGACGCCGGAGAGGACGCGGCGTCAGCAGCATCCAAGAAAATCAACAAAT
TGGCCAAACAGAAGAACAACGCAATGTTGCTGTTCAAGCAGGGGGAGCGAGCGTCGAATGGGGCGGCTTCGTACACGGTGGTGATCAAGAACACCATGCG
GTACCAACTAGCGATCGATCACGTTGGTGCAGGGATGTCGTTTAAGCAGACGGCGCTTGCAATCGGGCACGCCAAAAATCGGGCCAAAGTACTGGACCCA
AGCTGGCAGGCATCAACGATCTCATCGTCGGCCAGTATGTCCGCGTGCAAGTCGCAGTCGCGCTCCAACGTATTGGCGACATGCTGAACAATGACAAGCA
GGTGTGGGCGTTCTCGTTGGCCGGTGACGGTAGCACCCATCGCGGTCAGTCATTCTTCGATCTCCGCCTGCGCTTGTACTGGCACGGCCGTCTACTGAAC
CTGCACCTGGTCGCGCTTCCGATGTTCGACCGCCACACCGCCGAGAACATGTTCAACATGATTGTCAAACTCCTGGACGCGCTCTTCCCTAAGTGGCGGG
CGAAGTTGATTGGCGTGTCAAGCGACGGCGAGAATACGATGACCGGGCGCCACCGCGGCCTAGTCACGAGGCTTGTGGCTGCCGCCGAGTACAATGTCAT
GCGTGTCTGGTGCGCTCCGCACCAGATCGACATCATCGCCAAGGAGTGTGCTGACCGAATCGACGGCGGGACATGGATCAAGTTTGCCTACTCCTACACC
GTCTACCTGCGCGCCCAGTTCAATCTGATCATCGAGATGGGCGTCAAGTGCCCCCAAGAAGACGAACCGCTGGGTGCATCTCGGAAACGTGCTTAAATTC
TTGAAGGAAAACCGTCGCAGGCTGATGACGCACACCGAGGAGGATCGCCCCGATATGCTGCCGACTGACGCATGGTGGACCGTGACCTATGCTATCGCAC
CAGCCATCGACGCAATCAACATTGCGTTCGCCCAACTGCAGAACCGGTCGCTGCTCATGGCGCAGCAGGAGAGCCACATCATGGCGCTTGTTGCCACGAT
CAGCACCATGTTCGACCTTGAACTGATCGATCCCGACGACGCTGTCG