Description :
From Genome Similarity Track
Location :
Scaffold_209:15682- 17747
Transcript NameFunction/comments
Hyaar_Emoy2812628Amino Acid/Auxin Permease (AAAP) Family

Sequence
2065 bases(100 bases per row)
GCTTCACCTGGATGTGGTGCTCTGGATCTTAACCAGACGATCTTCTACTTGGTCTCAATATGCTCATCAGCAGCCGCAAATACTGGCTACTACAAACATG
GCAGGGACGTGAGCTAACAAAACGCACACACGGGCTAAGCCTGAGTCCGTCCGTGAGATAGGCTGTACAGCATGCATCGCTTGGGCTCCAATCGCTTCTT
TAACACAAAAGGTCCCGGGCACTTCGTACTAGCGCAATGGCTTTACACTTGCATCGAGTATGCGCTTGCTTGAAATAAAAGAACCGTCAAGTGAATCGGT
TCTGTCTGGCTCAATGTCGTGTACGGGAAAGGCATGTTTGCTGAAGCAAACCCTTTCAAGAGCTCCGTGGTCCGAGTCGAATAGGTATCGTGCGCGCTCA
CGTTGTTCATTTTTCAATTTCCTCCACCTGAGGTAGTTCACAACTAAACTTCCCCGGCATCCCATCAGCTGTCACCCCTCTGTGCCTCTCAATCATCCGC
AGAACCCATGCCCCATATCAAGGGCCCGTTCTTCACGCTGGAAGATGCGAAAACATCCTTTAATCTCTTCTGTTGCGTCTGCGGCATCGGATCGCTGGCC
ATGCCGTCCAATTACGCTCGTGCCGGTCCCGTATTCGCCACCGGGGCTCTCTTTTTCATGATCTTTGCCAACACGTACGCCACGCTCAAGTTGTCCAAAG
TGATGCTCGTGGCACCCTCCTCAGTGCGGACGTACGGTGACTTGGGCGAGTGGGCCCTGGGCAAGTGGGGCCGTTTCTTCACGGTAGCCTCGCAGATGGG
TGTGTGCCTCCTCGTCCCTATTGCATTCCTCATACTTGGAAGTACGATGCTGGAAGTGCTGTTTCCAGACTCGTTCAGTCAGATCTTCTGGATCACCTTC
ATGGCTCTTATGGTCGCCCCCGTGTGTCTGATTCCGACACTAAAAGAGAGTTCTGGTATGGCCTTCGCCGGTTGTCTCGGCACGATCATCGCTGATATCA
TTGCCGTGTCTGTGTTGCAGTGGAACATGCGGGGCCACACTTCTGCCCCTTCTCCTGCGATTTCGGCTCATCAGGTCTTGACGTGTTTCGGGAACCTCGC
ACTGGCCTACGGCGCTGCAATTGTCGTCCCTGATCTCCAACGTGAACATTCGCAGCCGCAGCGTATGCCGCGTGTCGTGTTGATCACGATCTTGTTCATC
TCGGCGCTCTTCATTGTCATGGCTCTGGCTGGCTACACTGCGGGTGGCTGCCAATTGTCCGGCAACATCCTCTACTCGATCGTGAACACGTCAGACCCCC
TTGGTTTGGCTCCTCTTGGCTTCAGTGCCGACCGTGGCGCCGTGGTGATGGCGTACTTGTTCATGCAGATCCACATCTCCATCGCCTTCTCGACGCTCAT
GATGCCACCGTTTTTTATAGCCGAGCGGCTGATTCTCGGCATGCACAAGGGCCCGGATGTGGTTCAATATAACGGAGAGCTGCTGGACCAGATGAACGTC
GAGATGGATCTCGAAACGCAGGAGAAGCGCTCGTACATGCAGAGCTCGACGCCTGTGGACATGACTCACTCCCGTCAAGTCTCGGCCGCTAGTCTCGCCG
AGAAAGAGTCAGGACGGATGTCGCACCTGCGGGTCGCGCTGGAGTTCGGTGGCATCACAGCAGAAGAAGTGAACGCGCCGTACCGCAAGAACCCGCTGCG
CTACGTGGCTCTGCGGCTCACGATCGTTGGCATCCTGGTGGTCATTGCTGTGCTGGCACGCAAGCGCTTTATCGACCTCCAGGACTTCACGGGCGCCACT
GCCCACACGACGAGCTGTTTGCTATTACCGGTGATCATCTACTGGCGAGTATGCTGGAAGTCCATGTCTATTTGGGACAAGGGGGCCTCCATGGTGGTCA
TTGTCGTCTGCGCCTTTGCAGGTACGTATGTGATGATTGATGCTGGCAAACACCTGTTCACGCCCACGGACGACCCCACGCTGTTCCCGTACTGTGACAC
GGAGTTCCAGGACGAACCGTACTATATCCGTAACAACAGCAGCAGCAGCAACTAAGTCGGAGCGG