Description :
From Genome Similarity Track
Location :
Scaffold_3:156802- 157892
Sequence
1090 bases(100 bases per row)
CAGCATACCGTCTAAGTGGATAATGGCACGGTCGAGACGGTCGAGCGAGCGGCTGAGCTTGTCGAATTTGTCCAGATCGTTGGCTTCAACCAGCTGCTCC
GACCGCGCAATGAGCTCTTTGTTCTCCTCCGCCTCGAACTTACGTCGACGACGAAGACGACACAGCGAGTCCTGCACGCGCTCCGTGATACGCGCCTGCA
TCTGCGGCACGTCCACGGACCAACAGAAGAACGTGAAGGCCGGATTATGGTCCGCGCGCTTGGGGATCTCCTGCATCTTGAGCACCTTGTCTGTATACAA
CTCGTACAGCCGGTGCCGCGCATCGTTAGACGGCAGCAGCGCCAGCTCGCCGATAGTTTTCTGCTCTAACTGACGTTTCTCCACCAGTAGACGTACGATA
CGCGCGCTCGCAACGCCATACTTGTCCTGGATGTACGCGTGAGTCGTGGCTTGTTGCAAGAACTCCATAATCTTCTGCATGTGCACCACATACTGGCCGC
CGTCACCTGCGCGCGCCTGGGTCGGGTCGAACGCCTCCTGAGCGACCTTCATCACCATTCCGGACTTGTCACGACACATGACCATAATGTAATTGAGTAA
GAGTCGCCACGGATTGTTCGCCTCAGCAGGCAGCGCGTTCTTGACGCTCTCCATGTTGAACAGATCACGCGCTGACACTGGAGCTGACGTAGGTTCGTCT
TTCTCGCGTTCACGTGGGGCCGAGTGCTGCAGCATGGCAGTCACAATGACGCCGGCGACAGCGTTGACGTTCTCTGTAGCAAACCGAATGCAAGCTTTGT
GTCGAAGATCACGTAGCAGTTGAGTCACGCCGAAGCGCCAGACCAAAGAACGCTCGTCCGTGTGAGCCCCAGAGCCACCAGGGGCGTCTTCGCCGCTGGT
CTCGCCACCGGTAGTTCCGTCTCCAGAGGACGTGCCGCGTGTGGGAAGTTTAGCACGCTTCGAGTTTTTCTTGCGCTTGGAGCCACGCGAAGACGTCGAC
GATGAGGCCGAACTAGGCTCCCACTCAGCTTCCGAGTCGTCTTTTTCCTTTCGAGCCGCTTCATCAGCGTCCAGCATCATTTGCAGCTCC