Description :
From Genome Similarity Track
Location :
Scaffold_1173:1568- 5811
Sequence
4243 bases(100 bases per row)
AGTCAAGCATCACGAGCTTCGTTGACCTGGAAGACTCGCTCGCGCCGGTGGCGCCTCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCGGCGTTGCT
GTACGCCAGGCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTG
CTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCACGGTGAATGAGGCAGAGTATACAGGTATGATAAACGGTG
TCAAGGCTGCTATTGCGCACGGTACCGAGGATTTAGTCATCGTTGGGGACTCAAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGA
AACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCGCGGCCAAGCTTCGATCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGAT
TCGTTAGCCACTGAAGCGCTGGAATCAAAGGTCAGTCGGGTAATCTTGGCTGAAAGTCGCAAGTCGGAATCGGCATCGCTGAACCGCATCCAGGAAATGA
TCTACGAGCCGGATGAAGACTGGGTAGATGTTTCGTCACAAGGAGCAGAGCGTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTT
CGAAAATTTCGTGGTTGATTACAGCTCACCAGAGTGTGATTATGGCAATATAGCAGTGATGACTCGGCGACAGACGAAATCCAAGAAACGCGTCAGGTTT
GCAGATGAACACTCGGAGGATGTCTCAAAAGCTCAAGAGGAGCATGAAGAACGACGAGAGACGTCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACC
ATCCTCACAAGACTGTACCATCGGCATTTCCCGATGCGGAAGATGTTGATCCGGTAGAGATACAGCAGGAACGACGCAGACGGATACTGGTGGCACAAGA
CGAGGAGCAGAAGTGGTTTAACATCAAGAAGGGGCTTCAGGGCCAAGCAGAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGACCGGTTCGTATTGT
CTGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTAGTAGTACCGACAACGATGAT
TCAAGAGGTCTTACAGAACTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCATCGCGTTAAGTCCGATTATTATTGGACCGGC
TTGTACGCTGACGTGGAGAAGCATGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAATCCGTCCACAGTTTCGTGGATACTCACCTGGCAACGTACTAG
CCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCAC
GGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGCTCGAAGAATGTGTGTCCCACGGTTCGAAGCCCCATCACTGA
TAAGGCAAAACCGCGACCCACGCTTCAGGAGCGAAGTTTTCCAAGCATTTGCAGAGATGATGTAGTCAAGATCACGAGCGACTTTGAGCTATCGGCCACA
GGCTAATGGACAGCAGGAACGCTCGGTGAAGTCGGTGATGGGTTCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAG
AAGCTAGGATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACGCCGTTCTACCTCGTTCACGGTTGGGATGCTCAGTCGACGTTGAGGGCAA
TGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGGCGCGAGATCAATCGACAGCATGAGGTCGCCCTCACTATGGCCAA
AGATTATCAGGCTGTAGAAAAGGAGCGACGAGCGAAAAAGCATAATGATGCTCTAAGTCGACTGGAAAAAGCCGCTGTACCTCAACCAAGTGGAAACGAA
CACTCGGCAGACCCTCTAGAAGCTTCAGAAGAGATGGAAGATCCTGCAAGAGCCCCACCGAGATCTCTTTTCGAGATTGGGAGCCGGGCGTGGTTGTACA
TGGAACGCGTCAAACCGGGCTTGACGAAGAAATTAGCTCACCGATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAGAGTTTGCGTACGAGCTGGA
ACTACCAGACCGAAGTGGGTATCGCTTCTACCCAGTAGTGCATGTGTCGAGACTCAAGGCTGTCAACGAGTTCAACAGTCGACCGAGCACTCGGTTGGTA
CTAGACGCGACTAATGAAGCAAGACTCGACTTCGATGAGGAACTGTTGCCTGAGGACAGCTGGGAACCGGATCAAGTTGCCGGTGAATATGAAGTCGAGG
CCATCCTCGACGACAGAACACCACTGACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTGGGCTATGAAGATACAACTTGGGAACC
ATCATCAAACTTGTCTTGTGGAGGTCTGCTGTACGACTATTTGCGAGCCAAGAAGAGCGAGAATCGGCTGCAGATGGCGCAAGTGGCGGACGAAGACTAG
CGTGACTGGATCACGTGTGAACTGGCCACAGGGCGATGCAGCCTGTGGTAACAGACGAAAAACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAA
CAACATGGACATGATTACGCTGTGGAAGTGGATTAAGAATAAGAAAACATGAATGCCGACCGGAGAGCGACCCCTGAAAGCGAAGTCACGCGGGATACCT
CAACAGTTGGCTGAGATGCTGGAGAACGTCGTGGAACACGCAGCGAGGACATCATCGAAACCAACAGCAGTCTCGAGGCGACGCTGAGTGTGCATATCGC
CGTGGAGAGGAGGCGCAACGCTGAGCTGCACTTGGTGACGAGCCATTGCAGTCAAGTACGGGATTATCGAGGTCATCATGTGATCGACCGATGCCTCCGT
ACTTTCAGCCAGCATGGCGCGCAGCGAATCTTCGGTGAGTGGTGGTGGACCACCAGCTGGGGCGAAAGGAGCAGCAGGAGCCATCTCCGCGGATTCAGCG
ACGACGGGGAGTGCTGCAGGAGCTACCGCAGGGAGTGAAGAGTCCAGGGCAGGAAGCGCCGAAGGACCAGTTGATGACGACGCTGTCGGAGGAAGTGTAG
CAGACTGAGGGACGTTCGAACCCTCGGTCTTGCCCTCCTGAGAAACAAGTCGAGTAATGCGAGGTGATGAGCAAGGTGCCGATGATTCAAGAGAAGGATG
AGCTGACGTACCTCCAGCTGTTCACGTTCGCGACGTCTACGAGGATTGAGACGCTGAAAAGCGTCGGACACGGCTTGATTCAGACGCTTGGACATACGGT
GGCGAGATGGTGAATTGAAGAATGAAGAAATGTCACAACGGGCACCAGTACCGTGGCTTCCATTGCGACAGGGGCAGTTGTGGTGTAGTGATTTCTCCGT
AGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGTTGTTCAAGCGACGAACCCTCGGTCAGGTGATGTACGGAGACGCCAAGGTGCAAG
GGACTCGACGGCGTCACCTCCGAGTTTTCAACAAGTATCGGATACGGCCCTATGTCACTGAATCCAGGCTGTCCTTATTATTAATAATGGACTGGCCGGA
TTCGCATTCAGCGGACCATCTACGGTACGAACCCTCAGTGGCGGTTGGGATGAGTTCGCGGAATACTCAGCGACCTTTGGAAGACACGTTCACCGTCTGG
GACAGGGCGCGGACCGTTAAAGATGCTCATGCGACGGTGCAGACGACGCTTGGCATGCAAGAAGATCCATAACGGATCATTGTTCACTTGATATTTGTAT
ACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAG
GTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCATTTGGCAAGGCCAAGAGGCTTTGTGTA
TTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGT