Description :
From Genome Similarity Track
Location :
Scaffold_729:1568- 5198
Sequence
3630 bases(100 bases per row)
GACGAATGCCCGCCATAACCATAAAATACATACCCAATATGGCTTCTTGGCCGACTTGATCACCGACCCAGACGTCGAAATATTACACCAACGATCCGTC
CAATGTAATCTTGATCTTTGTCCGCCCCACCGTCATATATACATTCTCTTCAATTCTGACGCACTCTTGTGATTGACTTTCATCGATCCCACATCCTACC
GTACGAGCAAAGGTTGTATCGAGGATCGACACTTCAGCGCCAGAGTCGAACATCATAGTGGATTTCTTATTGTTGATCTTGCCCGCCCCTTTTGCTTGCT
TGAACCATTTTCCAAGAATGTGAACTTCTAATACCCGCGTGATTCCCCAGGTGCGAGGTCTATCTTCATCTTCGCAGGCGATCGGGCATAATTATTCACC
TTCTTCACACTTGATATTGACGGGACCAATGTAAAATCATTATGTATATTAGCGATCGGATCAATCCGATTGTTAATCTCTTGATCATTTCGCTCTTATT
CAACAAATGCATAAATTCAAAGCAAAATTGCTCGGCTCGTGCCATATTCCAACCTGGCGAGCGTTCTAGTTTAACGTATCCTCCACCTTGGGCGGAAACG
ATCCAGCGTGCTTCGTGGGCTCGTACCACTTTCGGATCAAATTGAAAAATTCTTCCATGGAGCATTTGCGACCCTCGTGTATCTCTCCGTAGGCTGCACA
CACAAAGAAACATTTGTTAGAGTGATGTCGTTTGCGACCACATTTCTGGCACGTCAAACGCTTCCAGAACCCTCGATCGTCGTGTCTAGTAGATCCACAG
TGGGCAGACGCCCGCGATCGTCCAAAACGATCGTGATTATCCCCTCGACTAGTGTCCTTCTGCCAGGTGCGGTGATACTTGTCCGGTTTTCCTTGGTCAG
GTGTAGTTTTCGCTTAAACTCGGCAACGATCTACGTCTTCATCAGATCCATTTGACTCCGATTCCGATATACGTTTTTCGACTTTCTCGCGGATCGATTG
CACCGCCCGAGTTGCCTTTGATGACATCGGATTTGAAGACGCAGTCGTCCGCCGATGGAATTTGCTCGATCCCACTGACGCTTTCTTCTGGCGAGTCTCC
ATCCGCTGGCAGGAACGTTGGGGTTCCTCCATCTCATCAATATCCATCAATCGCAGTAGGGTCAGCTGCTTTGCCAGATCGCAATTGTCCAGAATAGCAA
TGAAGTGCCCCACATGTTCGCGACGTGTGGCCTATGTAGCCAATCTTTCTTCTCAAATCGCTATCTTGGCCTGCTTTGGCACAACATTAAGGCGATGCAG
GTACTCCAGGGGGGTTTCATCTGATCGCTTCCGTGCGAGATAATATTGTCTGGCCACAGACACACCTTGCCCTCCATATTGTATCATAAAACGGTCCAGC
AATCGCTTACATTTGTACCATGTAGATCGACTCAGTTGGTTGTACCAGTTTTGTTCTGGCCCTATCGACAGGTCACCATACACCAAACACATTTCTTCAT
CTGACTCCTGCTCGCGCAGGAAAGCCGACTTAACTTTGTCATTCCAGCTTCTGGCCCGATCTTTGCCTCTGTCTTTGCCATTGAATTCTTTCAGCTCTGT
CATCACTGACACACGAATACTTTAGGGGAACTCCGCCACTATTCTGTAACGTTTCTGTGATGGCTACCAACGCACTTCTTCGCTCTTCTTGCCTCGAATT
ATCGGGACCGACATCTTCAGGATCGAAAATGCCCGATCGACTCAGATGCGTTTGGACCGATTCCATCTCGACATATGGGGTGTATGCTTCTTGGGCTTTT
GCAATTTTGATCCTTTCACTAGGGTGAATCGCTTAATACGCTCGTTTCCGTCGTTCTTGTTGAAAACGTTCCATGGACTCCACGAGGTTCGCCTGCAGGT
GGCCTTGCGTAGTCGAAATCATCTCTATATTAGCGCGTGCGGTAGTCGATCGTGGTTCAATCTTTATCGTTTCAACTAGATCACGCAGATGTGCCGCCCT
AATTGGGCCTAAAGACATCCGATGAATGCCGATTGAATCATCAGAGTCGATTTCAGATTCAGCTGAGGCGTACTGCAACGATCTGGTGAGGTATACTCTC
GGAACGTCTGCGATTGCTATGTCTGTTTGATCGGTAGGGTCGCACTTTCCCATCAGAGGAGTTAACGTGTCATATTGCAATCGATACGCATGGATCACCT
GGTCTTTTTCGAACTCCAACAAATAGTTCACGTTGAACACCTCGGCGTCATGGAGAACCCGTATGATCCCGTTGACCTCGTCCGGCGCATTAGATGCTAC
TGCCGGTGGGTGTATCGGACCTTGGATCCCTCCGATCAGCTTGGGCTTCAGTTCCGGAGCACTGGCTTTCTTGATAGAGAATTGTTGAGTGTCTTCCAGT
GATATCTGCTCGCCAACTGATCCAGCTGCCAGCCTTCCATCTTCATATTATCTTCCACGAACTTGATCTGTTGATTGATCGATTTCAAGTTGCGATCGTG
TTGATCCGATCTGAGCGCTTCTTTCTTTACTCGTGCTGTCTTTACGTTCTTCGTCTTGACTTTTCTTGAGTGGTTTTGAGTGATAACTGATCGGTTTTAT
CCGAACGGTTCTCATCTAACGGATCGTACTTTACGGCACAATCGGCGGTAGTCCCTAAAAGGACCTCAAGAGGGGGTCGAGTTTTCTCTTCCAGATCGAT
CAACCGAACTTCCTCTTTAATTTTTTTGTCATCAGAGCCCCTCCCGAAACTCCGATAATCTGGGGATACTTAAACCACGCGTCTGGGGTGATCTCTATGC
CTCTGACGTTTCAATCCCAGATTCAGTCTTGATCCTGGCGTCTACCTAAGAAACCCACGGTGAAATTTCGAGTCACCAGAAGATCCGGGCACGCGCACCA
TTGTGGTGGAGTGGCGATCGCTCATTTTATTGAGGCGACCACAACTTCCCACTGGCGCCCAGACGACCGACTAACGGAGGGGGTACTCCGATTCCGTGTA
GATGTATTCCTTCCCCACCTCGTGTACACGTCCGTAGGGCGGACTGAACTCTTTTTGGTGGACTCGAGGGAAAACTTGGCCGTGTTGGAAATGGGTTGGT
GTGATCGTGCGAAAACCTTCACACGATCATGAGTGTACTAATAGGGTGCTAGATATAAGTCGCTCAGATCTCAACGAGATCCCGGCTCAATATGAAGATG
ATTGAAAGGCTTGACCTTCTGACCACTTGATACGTCTCGCGATCTTGCACCTTTTCCTTTACGTTGTAGCTGCGTCCGATCGCAGTTGGGTTGTCTTGAG
AATTCTTGATCCCCAGCCAATTATCTGGGGATGTCACTTGGTTTCAGTATGTGAGACTATCTTGACGTCGGGAGGCCAAATATCCACCCGGAAGAGAAGT
CGACACGTGTACTTCAAAGCAAATAGAATTCTGTTTCATGTTTACCAGCTCAAGCTGGAACTACGATTATGCCTGTCTGTATACCAGGAAATGCTGCCAC
GCTTCCTCTATATTCCGTTAATCGTTCTTTGTATATGTGGTCCGGACTTGTCTCACGCAGTCTCAATTGATCGGGGCTAGATCGTGATCACGACTGATCG
TCGATCACCCTTCAGATCACGATCACTGCC