Description :
From Genome Similarity Track
Location :
Scaffold_131:1568- 3485
Sequence
1917 bases(100 bases per row)
GGTGCCGTCGCCGACATCCATCAATCGCAGTAGTGTCAGCTGTTTTGCCAGATCACGATCGTTTAGCGTAGCAATGAAGTGATCCACATGTTCGCGACGT
GTGGCCGAAGTAGCCAATATTTATTCTTTGATCGCGATCTTGGCGTGCTTTGCTACAACATTAAGGCGATGCAAGTAATCCAGCGGGGTTTCATCTGATC
GCTTCCGTGCGAGATAATATTGCCTAGCCACACACACCCTTTGCCCTCCATACTAATAATGAATCAATCCAGCAATCACTTCCACTTGTGTCGAGTAGAT
CCACTCAGTTGGTTGTACTAGTTTCGTGCTGATCCTATCAACAGATCTCCGAACACCAAACAATATTCTTCGTCTGGTGCCGGATCGCGCAGGAACGCCG
ACTTGACCTTGCTGATCCAGCTTCTGGCCTTATCTTCATCTCTGTCTTTGCCACTGAATTCTTTCAGCTCCGTCATCGCTGACACACGAATACGTTAAGG
AATCCCACGACCATTCTGCAAATTACTGCGGTGGCCACCATCGCACGTCTCCCCTCTTTTTGACCCGAATCATCGGGATCGACGCCTTCCGGGTCGAAAA
TGGCCGATTGACTACGATGCGATCGGACCGATTACATCTCGACATCTGGGGTGTATGCTTCCTGAACTCTTGTAGCATTGGTTCTTTGGCTAGAATAGAT
CGCTTGATACGCTTGCTCCCCTTTTTTGTTGAAAACACTTTATGGCCTCATCGAGGTACGCCTGCATGTGTCCTTGCGTAGTCAAATTCGTATCTCTTTT
AGCACGTGCGTTATTCGATCGTGGTTCGGTTTTGATCGTTTCAACCCGATCGCGCAGATGCGCTGCTCCACTTGGGCCTAGAGAAATCTGCTGAATACCG
ATCGAATTATCTGACTCGATTTCGGATAAAGCTGACGCGTACTGCGACGATCCGATGTGGTATCCTTTCGGGGTGTCTACGATCGCTGCTTCTGCTTAAT
CCGTAGGATCACACTTACCCGTTCGGGGAATTAACTTGTTGTACAGCGATTGATACGCAAGGTTCACCTGATGTTGATCGCTTTCCACAATTTGGTATGC
GTCGAACACCCCTGCGACAAAATCAGCGTCATGTAGCAGCCGTATGATCCCGTTGATCTCTTCCAGTATATCAGACGCTATTGCCGGTGGGGGCATCGGA
CCTTGGATTCCTCCGATCAGCTTGGGCTATACAATCCGGAGCACTGTGTCACTTGATAGAAGATTATTACGTTACTTCCAGTGGTATCCCTCCGCCAACT
GATCCAGCTGCCAGCCTTCCATCTTCATATTGTCGCCCACGAACTTGATGGGTCGGTTGATCGATTTCAAACTGCGATCGTGCTGATCCGATCTTGTCGC
TTCTTTCTTCACTCGTGCTGTCTTCACGTTCTTCGTCTTTTATTTTGCTTGAGTGGTCTTGGGTGATAACTGTTCGGGTTTATCCGAAGGGTTTTCAACC
AGCAGGTCGTGCTTTGCGGCACGATCCGCGGTGGTCCCTGAAGGGACCTCAAGAGGGGGTCGAGGTTTCTCTTCCAGATCGAGAGATCGATTTTCCTCTT
TGATTTTATTATCATCAGAGCCGCTTTCAAAACGCCGATATCCTGATGATTCTTTAAGAATCACGCATCGGGGGCGATCCCACTGTCTCTAACGCTTCCA
TCCCAGGTTCTGTATTTATTTTCATCTCTTCACTCCGGGACCACGGTGAAATCCCGAGTCACCAGAAGTTCTTGGCATGCGCACCATTGTGGTGGAGTGG
CAATCGCTCATTTTATGAGGTGATCCCAACTCTCCACTGGTGCCCAGACGACCGACTATCGGGGGGGGGGGTACGCCGTTTCCTTGCCTTGTATTTCCTT
CCTCACCTTGTTTAACC