Description :
From Genome Similarity Track
Location :
Scaffold_28:1568- 2762
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_28-fgenesh-gene-0.4HECT ubiquitin ligase

Sequence
1194 bases(100 bases per row)
CCGTGGTGAAGCCATGCCGCGTGCCCATGATCGACGCGCGCACGGCAGTGCGCATGTTACCTAAAAATCCGTGGAGGGGCACCTCCAGCGTGTTGAAGCA
CGCGTGACTGTGGAGGTATCCGTACGTGGTCTCTGGCGCCACGCCCTTGAGCGTGAAGAGGCAGAGCCGCCCGTCGTGGCTCGTCAGGGCGNNNNNNNNN
NNNNNNNNNCGCCCGGCGGCACCCGCGTGGAGCCCGTGGCGAACTGGAGCAACCGCCGCAGCTCGTCGTTGCTGAGCTCGCGCATGATGGTCCAGAAGAG
CTCGTACGCTGGGTGGAAGATGAGGTCCATGGAGGCCACCGTGTGGGCCTGCCAGTCGTCCACGTCGATCTCGTCCGAGCCGGACAGCATGTAGTCGAGC
TCTTCCGGATCAAAGAGCATCAAGAGGTCGGGCGGCACGACCTCGTAGATACCCTTTAGAAGCGCGAGCAGCTGGTCCGAGACGCTCTCGAAGAGCAGAT
ACTGGAGTTTGCGGTCAATGTACTGGCGCTTGTTCGCGTCCGTGACGTCGAGCTGACTGCCGCCCGGCACGAGCTCAACCTCACGGGTGGTTCCGTCGGG
CAGGATCTCGGTCACGGTAAAGTCCAGTCCCAGCGCGTCGACGCCATCGTTCTGGAGAAGCCACGTGAGATGCTTGTACGCTTCGGAATCAAAGTACTCA
AGATCGCTGACGCTCACGGGAATGCCGAGAATGATCTTGAGCAGCGGTGGCGCCAAGTGGAAGCCTGTGACGTTGCCTTCAAGAAGCGCGCGACCGAGCA
GCCGCCCAGCCGAGAGGAAATGGGCCAAGTGGGTCTCGCCCAGTACATGCTGGGAGTGTGGGTTGAGGTAGAACACCTGCTCGTCGTGGTCGACACACAC
GAAAAGACCGGCAGCGGGCGTGATGATACTCTGGTTGAGCAGTACGAACCACTCGCGGTACACACCACCCGCGTCGATGCCGTGCTCGGCCGTGAACTCG
ACGCGGATCGCTCCACGGGCTTGCGTAGGTGTCATGGTGGCCATGGCCGCAATCGAGTCGGCGAGGAGGTTTTCGCGGTCGATGAAGAACCGCGATTTGT
TTCGGACTTCGTCTCCTTCTTCGTCGTGGTCGGCCGACTCGTGGAACAGCTCGGCCATGGTCGTGATGAACTGCGCGAGCTTGCTCGGAAAGTC