Description :
From Genome Similarity Track
Location :
Scaffold_23:156756- 158093
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06632folate-Biopterin Transporter (FBT) family
Sappa_CBS223.65SPRG_06633Hypothetical protein

Sequence
1337 bases(100 bases per row)
CCAAGCTCTCTTGGCGCCGTCCGAGGCGTAGAAATGCGATGGACCTATACTAGAAGAGTGTCTCGAATATTATTGTGTGCAGAGACATCCACGTCTGTTA
TTTGTCGATGCGTCTAAGGTTCAAGTCATATTTCGTGCACGAGTACGTTCTAGAGAGCTCTACGTGATGGAGACGTCTGCGATACTCAACGAGATCCAAG
AGCACTTGGACTACGTTGATGACTGGGCAGCGGACAGCACGCTGATTCTTCACTTTGATGTGGCAAGGGTTCTGGCGCTCGTAAAGCTCCCGTCGTCTAA
TCTACATGACTGCTGTCGATTCACTCGTCGAGATGTACAATTGCAAACTGATCGATGTAGGCGCACGACTGCGCAGCTTCAACACATGAACAATGTAACC
AATACCAAGATCGACTCGACGACCGCTGCAGCGCCGGCTTGAACGCATCACCGACGTCACTTGGAGTCGTGTGCGTGTAAGATATAATGGTATATCGAGG
GCGTGAGGGTAGCATGGCAACTAGGCGTCGAGACGAGGGCGCTTTAACGGCGGTTGCGCGTCGTTCATGTCCGCCGCCTCGATCGCGCGCACCGGCTGGA
GAAGCAGCTGGAGCTTCGCGACGGCCTTGGTGTCGCGGTGCAGATGGCTCAGGCGTTCAATGTGATGCTCGAGACCCATCTTGCGGCCAACCTGCGTCGT
GCGCTTCCGAACGACGTATGGGCCCCTCATCGCCTCGCCCATCGAGTTGTTCCCGCCACGCACGTCGACACGGAAGAGATCGTCCGTCATGGGAAAAATA
AGCTCGACGTCGTCGTGGTGCAATCCGAGCTGGCCTTGATGGCTGGCAATTTCATCCAGGAGTGCCTCGCAGAGACCAGCAAACTCAAACTCAATCCGCG
TGCCATCACGCAAAAAGACGACAAACGCAGCGCACTGCGCGCAGTGGTCGACGTCGACGGCAATGTCATCGATGACGACATTGCTCACGTCGGGCACGGG
CGCCCGGTCTTTGTGAAAGTTGGCCAGACACTGCGCGGCCAAGTCCGAAATGAGGCCAGTGTCGTGCGGGAGCCGCTTCGTCGCCTCGACGACGACAGAG
TAGAGCGCGTGGCGGGTGGCATCCAGCGTCTCTGGTAGCGCCGCAGCCCACGCGAGGCCGAACGTTCGCACTTCGTGTGGCGCCACGAGCGTGAGCACAT
GGAGGGCGTCGACGACACTCTTGACCGACGGGGCGAGGGCCTTGCTTTCTCGCATGCGACCGAAGGCGTCGGTGACGGTAAATGACGGTGCGATCGAGAA
GACGTAGCTGGCCACGAGCGACTGCACACGGGACGCG