Description :
From Genome Similarity Track
Location :
contig_7:156755- 158006
Transcript NameFunction/comments
g2483.t1hypothetical protein

Sequence
1251 bases(100 bases per row)
ATTACACCATTGCACGGCGTTATTCACAAAGTCAACACTCAAATTCAAAAAGTGCGCACTCAAAATCAAAAACCTGTCAGATGTATTACCCTTGAAAATG
ATACTACGTCTCAGATCTTATCAAAAGTTACGTCCCAACTTCCATGTCCTCAAAGTGCAGCGTGCACTGGTGATGAGGCAGTGAATGGCAAAAACTCGAT
TGGACAGCGCTGGGGTCACCACTTCGGCAAACAGGGGGTCTGCAGCGAGCTTGAGATACCCGGCACGATGCTCCGTAATCGTTGTGCCGTCGGGGACGCG
CAGGATGCCAGGACGTTGTCGCGCGAGAAAGCGTTTCACAGCACTCTTGTAGACAGAAAATACATTCTCTATCGGGTTCAGCATAGGGGAGTATGGCCCT
AGCTTCAGCATCTCGGCATCTTGGAATTCCTCCTCGGCGAACACATCCTTAGCGTTGGTGTGACACGGGGCATTGTCGAGCACGAGCACGACTTCATCCA
GAGGGGTGGAGGTCTTGATGCGGCGCAGGAATCGCCTGATAAACTCGTTCGCGAGTCCAGCAGTGAACGAGCCGAACTGCGACTCTTGGAAGGCTAGGCC
AGTACTTGAGATAACAGCAATAATATTAATATGTTTACCCTTACTGGAAACACCAGTCTGTACTGCGCGCTGCCCCAGCTTGCTCCAGACACGCCCACAA
GTTAATGTTCGTTTCATCCAAATAAAATACCTTCTTGTCGTTAGCGAGTGCTGCGTAGAACTTGATCACGTACTCGTAGCTTTTCTGTTTGTTGATTGAG
CTGTTGCGGTTCACAACGTCTCGGTGCAACTTCTTGAGAGTGAAGCTGCGGGCGTCTAGAGCTCGCCGCACGGTCTCCCGGTTGACAGCCACGTCGAACT
TCTGCTCAACAAGGTGTACCATCTGGACTAGCGTCAACTCTGGCGTCGTTTCGATATCACTGAGCAGGTAATCGACGTGAACAACAAGTAGCTTTTTTGA
TGACCCGCCGCGTTGATGTTGGTCACCACTCCAGTCTCCAGTCTCCATGGCCCTCTTGATCCAGCCCCATGAAATACGCTCGTTGACGGTGTGGAGCTCC
GCCACGGTTTCCAGTCACCAGCGTTCTTTGCCACTCGCAGGATAGCCACACGCACCTGACTTGGGTACGTCTTGTACTTGGTAGTTGGCATGGTGCCAAA
ACAGAAATGAGCCTGTTGGTTATGCGAGCGCATGCTTCGCACTAAGTTTCC