Description :
From Genome Similarity Track
Location :
contig_7:156740- 157996
Transcript NameFunction/comments
g2340.t1hypothetical protein

Sequence
1256 bases(100 bases per row)
ATTACACCATTGCACGGCGTTGTTCACAAAGTCAACACTCAAATTCAAAAAGTGCGCACTCAAAATCAAAAACCTGTCAGATGTATTACCCTTGAAAATG
ATACTACGTCTCAGATCTTATCAAAAGTTACGTCCCAACTTCCATGTCGTCAAAGTGCAGCGTGCACTGGTGATGAGGCAGTGAATGGCAAAAACTCGAT
TGGACAGCGCTGGGGTCACCACTTCGGCAAACAGGGGGTCTGCAGCGAGCTTGAGATACCCGGCACGATGCTCCGTAATCGTTGTGCCGTCGGGGACGCG
CAGGATGCCAGGACGTTGTCGCGCGAGAAAGCGTTTCACAGCACTCTTGTAGACAGAAAATACATTCTCTATCGGGTTCAGCATAGGGGAGTATGGCCCT
AGCTTCAGCATCTCGGCATCTTGGAATTCCTCCTCGGCGAACACATCCTTAGCGTTGGTGTGACACGGGGCATTGTCGAGCACGAGCACGACTTCATCCA
GAGGGGTGGAGGTCTTGATGCGGCGCAGGAATCGCCTGATAAACTCGTTCGCGAGTCCAGCAGTGAACGAGCCGAACTGCGACTCTTGGAAGGCTAGGCC
AGTACTTGAGATAACAGCAATAATATTAATATGTTTACCCTTACTGGAAACACCAGTCTGTACTGCGCGCTGCCCCAGCTTGCTCCAGACACGCCCACAA
GTTAATGTTCGTTTCATCCAAATAAAATACCTTCTTGTCGTTAGCGAGTGCTGCGTAGAACTTGATCACGTACTCGTAGCTTTTCTGTTTGTTGATTGAG
CTGTTGCGGTTCACAACGTCTCGGTGCAACTTCTTGAGAGTGAAGCTGCGGGCGTCTAGAGCTCGCCGCACGGTCTCCCGGTTGACAGCCACGTCGAACT
TCTGCTCAACAAGGTGTACCATCTGGACTAGCGTCAACTCTGGCGTCGTTTCGATATCACTGAGCAGGTAATCGACGTGAACAACAAGTAGCTTTTTTGA
TGACCCGCCGCGTTGATGTTGGTCACCACTCCAGTCTCCAGTCTCCATGGCCCTCTTGATCCAGCCCCATGAAATACGCTCGTTGACGGTGTGGAGCTCC
GCCACGGTTTCCAGTCACCAGCGTTCTTTGCCACTCGCAGGATAGCCACACGCACCTGACTTGGGTACGTCTTGTACTTGGTAGTTGGCATGGTGCCAAA
ACAGAAATGAGCCTGTTGGTTATGCGAGCGCATGCTTCGCACTAAGTTTCCCGCCA