Description :
From Genome Similarity Track
Location :
Scaffold_91:156726- 159550
Sequence
2824 bases(100 bases per row)
cacacacgtatccgtgagactctacttgaaccctgcgtgcaacgtcttcttgtgcagcaatttattccagaggcgatcagcctgcttcaggccgtagagg
ctccagtgccagcttcgactcgtcgtcgacacctaatcccttgaggacctccacggcaaattccatcccctccggtagatatatgaagatctccagttcg
gcctccttatcagccttcacgtacgcgttcgggccgtccctgtgcttcgctggtatacaccattcgcgtgcctacgtcagtatgatctttacaccgctga
gtcccattacacccgcgaacgtcaactcgcaactgacgccgaactcttactcgttccagcaggctaccagtcgcgccttcaggcgctcaccgcctcctcc
agcgccctgtttggtcatcaagaaccattttgggtgcgaaatgtgcatcacacggggcgcctatacgacttatcacactccattttcctcgaggtcccgc
agttcctcgaccattgctttcctccacccgttactacgctcgctgcgcatggcctgccatcgttcttggggtcgccttccaccacactgttgacgacgcc
tccagtcgttcttggggtcgccttccaccacactgttgacgacgccgccattcgcctccgcctgctctgcggacgcgtccgcacgtcctgctgttttgcg
cgtgaaagagcgcgtggcatgacgctcacgctgccacgttttattcctggccttcttcgttaacctcctcgcgtggtctcttccgggacgtgccccgtca
tcggcgtcagtagtcttagagacaccagtgtctccgcccgtctgcgtagcctcatccgtttccacgtctttgttgaggtagagtctctggacctggccat
tctgctcctttctgagtgtcgcgatgttctttaggtcctgggggcgaacaccacgcaatccttcgggatgtacaccctgtacccttccgtctcttcgcca
atacccatgatcatcccatgctgtgtccggtgagaggagttcttgcacttcggccccctatagaccgtacacggcgaaccaaaaactacgatctccccca
gcgatggtgtctccttcgtcaggattttcattggagaggcacgcccgggttggaattggtcggtgatctgttcaatatgtacacagcatactcagtggca
atccacaagcaaaaatcatgcatctggccatatttagtacggttcggtgcatgcgctcggctttcccgttgctggcttggttgttcgctccgtccctccc
gcgcacaacccccattctcttacagaacaggtttaagttttgatattcccctcccgaatccatcctcagcacatgaatctggcagttgaatcactttcga
agaacacatgaaaatgctcgaattgtttcgccgtagcgctcttcgtattgaccaagagcaccctgcaataatcgctcttgtggtccacgaagttaatcat
ataccggtcctgcagccgatctcgaggcgtcattggacccttgcggtctgagcagatgaccccacccaccgggtgtatcggtgagtggtcacccgaatct
ttcctggactgacgatccttggcctatttgccctacgcgcaggtcaagcggttagctctcctgtggtctgtgagttgaatctcagagctagagtcgttcc
cgaggcgttccacggcgtcgtagttgaggtgtccaagtcggtggaactctgtcaatggccccttttgtactgctctgttcgcgtccactgagcctgctgc
ctcctagcccagacctgccaagatagcccccgacaggggccttaatctccctttcaacctagcatggcgccatcagcgcaatccgcatcggatccatgtc
gaaggcgacctccccccatctctggcgtccagggcgcaccgtccacccttgtgagtaagcacataccccttcttgcctaacagcccgtaaggtatccgat
tgtgaccgacatttttcgaataaaacagatctgagagcttgatcgtctgttccacctcgcacgcggccactcggtgattcactgttcccctcttagtcac
gactaacggcttaccatttggctgaacagcgatcatcacagttctccgcttcctctagacacgcctcgccgtttacaaaatgccttctggattagctgtc
taggatccactcctcctccgagtcgtccgacgtctcgcctaccgtcagcttgagctccgcttcctcgtccttatttggacacgccgttcacaagtgtcca
gcttcaccgcacttgtggtatctctgggtttccttccggcgctcgctaacgttgttcacgacgtcttgtccgagcttcttgtgcttcgtcggctccagct
cccaggcctgagcgaagtgcgcgatctcttcagcgttgctggagaaagtcgctcctcgctccgtcagcttttgctatcagaacagtacttaaatccgcgg
aagcgtattgaatgatggtattcagaaccatgtagtcagcgccgcctccacaggactctgatatcgccacgagataatgtaatgctcgggccatgttcgc
ttcgggtcattcggggccgcggacaacttcatcgttggcgccgacatgatggtagccttaaatgtttcctgcattcgttccatggcgtactgtagcgtcg
gtagttgcgcccaccagacttcaacctgcttgttgaaatacatctccgcgacgtctgccaggtagtgccccaaaaggtatactttcacgtcctccggcca
gttgaacccgcacgcctgttgtgc